ADAM17 (NM_003183) Human 3' UTR Clone

CAT#: SC211049

3`UTR clone of ADAM metallopeptidase domain 17 (ADAM17) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ADAM17
• Synonyms: ADAM18; CD156B; CSVP; NISBD; NISBD1; TACE
• ACCN: NM_003183
• Insert Size: 930 bp
• Sequence Data:
  Insert Sequence

  >SC211049 3'UTR clone of NM_003183
  The sequence shown below is from the reference sequence of NM_003183. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAGCGTCAGAATCGTGTTGACAGCAAAGAAACAGAGTGCTAATTTAGTTCTCAGCTCTTCTGACTTAAGT
  GTGCAAAATATTTTTATAGATTTGACCTACAAATCAATCACAGCTTGTATTTTGTGAAGACTGGGAAGTG
  ACTTAGCAGATGCTGGTCATGTGTTTGAACTTCCTGCAGGTAAACAGTTCTTGTGTGGTTTGGCCCTTCT
  CCTTTTGAAAAGGTAAGGTGAAGGTGAATCTAGCTTATTTTGAGGCTTTCAGGTTTTAGTTTTTAAAATA
  TCTTTTGACCTGTGGTGCAAAAGCAGAAAATACAGCTGGATTGGGTTATGAATATTTACGTTTTTGTAAA
  TTAATCTTTTATATTGATAACAGCACTGACTAGGGAAATGATCAGTTTTTTTTTATACACTGTAATGAAC
  CGCTGAATATGAGGCATTTGGCATTTATTTGTGATGACAACTGGAATAGTTTTTTTTTTTTTTTTTTTTT
  TTTGCCTTCAACTAAAAACAAAGGAGATAAATCTAGTATACATTGTCTCTAAATTGTGGGTCTATTTCTA
  GTTATTACCCAGAGTTTTTATGTAGCAGGGAAAATATATATCTAAATTTAGAAATCATTTGGGTTAATAT
  GGCTCTTCATAATTCTAAGACTAATGCTCTCTAGAAACCTAACCACCTACCTTACAGTGAGGGCTATACA
  TGGTAGCCAGTTGAATTTATGGAATCTACCAACTGTTTAGGGCCCTGATTTGCTGGGCAGTTTTTCTGTA
  TTTTATAAGTATCTTCATGTATCCCTGTTACTGATAGGGATACATGCTCTTAGAAAATTCACTATTGGCT
  GGGAGTGGTGGCTCATGCCTGTAATCCCAGCACTTGGAGAGGCTGAGGTTGCGCCACTACACTCCAGCCT
  GGGTGACAGAGTGAGACTCT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_003183.4
• Summary: 'This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biologic processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The encoded preproprotein is proteolytically processed to generate the mature protease. The encoded protease functions in the ectodomain shedding of tumor necrosis factor-alpha, in which soluble tumor necrosis factor-alpha is released from the membrane-bound precursor. This protease also functions in the processing of numerous other substrates, including cell adhesion proteins, cytokine and growth factor receptors and epidermal growth factor (EGF) receptor ligands, and plays a prominent role in the activation of the Notch signaling pathway. Elevated expression of this gene has been observed in specific cell types derived from psoriasis, rheumatoid arthritis, multiple sclerosis and Crohn's disease patients, suggesting that the encoded protein may play a role in autoimmune disease. Additionally, this protease may play a role in viral infection through its cleavage of ACE2, the cellular receptor for SARS-CoV and SARS-CoV-2. [provided by RefSeq, Aug 2020]'
• Locus ID: 6868