PKA R2 (PRKAR2A) (NM_004157) Human 3' UTR Clone

CAT#: SC211140

3`UTR clone of protein kinase cAMP-dependent regulatory type II alpha (PRKAR2A) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PRKAR2A
• Synonyms: PKR2; PRKAR2
• ACCN: NM_004157
• Insert Size: 952 bp
• Sequence Data:
  Insert Sequence

  >SC211140 3'UTR clone of NM_004157
  The sequence shown below is from the reference sequence of NM_004157. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GATGTTTGGCTCCAGCGTGGATCTGGGCAACCTCGGGCAGTAGGTGTGCCACACCCCAGAGCCTTCTTAG
  TGTGACACCAAAACCTTCTGGTCAGCCACAGAACACATACAGAAAACAGACATGACAGAACTGTTCCTGC
  CGTTGCCGCCACTGCTGCCATTGCTGTGGTTATGGGCATTTAGAAAACTTGAAAGTCAGCACTAAAGGAT
  GGGCAGAGGTTCAACCCACACCTCCACTTTGCTTCTGAAGGCCCATTCATTAGACCACTTGTAAAGATTA
  CTCCAACCCAGTTTTTATATCTTTGGTTCAAAACGGCATGTCTCTCCAACAATTTAAGTGCCTGATACAA
  AGTCCAAAGTATAAACATGCTCCTTTCCTCTCTTGCTGCTACTCTTGCTTTTGGAAGTTACCACAGGGTC
  TGCAGAAACCTGTTGTATAACTGTAGACACTCTCTAATGGTTCTCAAAGGAGGAAATGTAGCCTTCAGTC
  TCCTCATTTGTCCTTTGAGGAAGTCCACATTTGTTCACAGTTGCAGCCTTTGGTTTTACAGTGGGAAATG
  GTGGTGGATGATATGGACATATGTAGCCCAGTGGCATTGTACTTTCTGCTGACAGCTGCACACATTACAG
  CTGTCTCCAAACCCACAGTGATGCTTAGGGAAAGACCCTGCTCAGGACCCAGCAGGTCAGCACCCCAGAG
  CAGACTGATAGGTCCGTGGGACCCATGTTAGAGCAGAAAATTTGGGCTCAGCACATTTTACTGTTAGTAG
  AGAGCCAGGAAACGTTTTCTGGGTTGGGGATTTTGTGGGATTTTTTAATTTTTTTAGTAGGTTTTGTTTA
  ACCTCTGTGCAGTTTGTATGAATGAATTGCTATACATTTATAAGGAGCCAGGGTCTGGAGGGTTGCTATC
  ACTTTGTCCAGCCCAAATACCTTCCTGGGCAACTCCTACCAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004157.2
• Summary: 'cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase, which transduces the signal through phosphorylation of different target proteins. The inactive kinase holoenzyme is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits have been identified in humans. The protein encoded by this gene is one of the regulatory subunits. This subunit can be phosphorylated by the activated catalytic subunit. It may interact with various A-kinase anchoring proteins and determine the subcellular localization of cAMP-dependent protein kinase. This subunit has been shown to regulate protein transport from endosomes to the Golgi apparatus and further to the endoplasmic reticulum (ER). [provided by RefSeq, Jul 2008]'
• Locus ID: 5576