ACCN1 (ASIC2) (NM_001094) Human 3' UTR Clone

CAT#: SC211215

3`UTR clone of amiloride-sensitive cation channel 1 neuronal (ACCN1) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ASIC2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ASIC2
Synonyms ACCN; ACCN1; ASIC2a; BNaC1; BNC1; hBNaC1; MDEG
ACCN NM_001094
Insert Size 875 bp
Sequence Data
>SC211215 3'UTR clone of NM_001094
The sequence shown below is from the reference sequence of NM_001094. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TTGGAGGAGATTGCCTGCTGACACCCCTCGAGTCACCCAGCACTCCCTCCAAACAGACCTTGAGGCCCAA
GACCCAGGACAAGGAACAGCAAGCTCAGGTGGGATGGCCCCAGTGCTGGAAAGAAGCAAGAGCCCCCTAT
GCACACATTGCAGACTAGCTGCCTAGACCTCGCTCCGGCCACGTCCAACACGACGCATCCTTGGGCCCCG
CCGTGCGTCCCTCTTAGGAGAGATGAGTCACACTCTGGAACTGTCCAAGAACGAACCTGCCATCACATCT
CACTGCCAGATGTATAAAGCACCTGCATGCTCAGACTTCTTGTGGCGCCACCTCCACGTCTGTCTTGTAC
ATGACACTCCTCCACGCGGTTTCCAGTGTCCACACTGCTGCCCGTGCAGTGGGACCAGATTCCAGGTCCA
AAGTCACCATGAGGCCACCCTGGAATCAGAACTGCACAATCAAGAGGGAACCCATGGGACTCTCTGCTAC
ATTCAGTTCTTGTGTCGTTTGTGAAAGTTCTTAACCTGCCCAAAAACCCCCTTTTCCCCAAGCTGCCCAT
GGGGCTTCGGCGCCAAAGGTGACCCGCGCCAACCTCCCTCCCCCCCAGTGCCTATGACGGCGGCACAGCA
GCCAGCGGGTGGGGGACGCCTGTGTTCACCCATGGTGCCCATGTCGTTCTTCTCTCCCTGTGACACAGCT
TGTACAGTCTGATTCTTTTTATCTGGGGTAGGGGGGCTTTTATGTTTGTCCGATGGAGATTTGTTTTGTT
TTGCTTCATTTTATGCTTTTTTATTTTAGTTTTGATGTTCTGAGGTTTGCTTTGGTTTTTCCATTTTCTT
TGGCATTTATTTATTCGTGCTTCAAATCACAGTCA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001094.4
Summary 'This gene encodes a member of the degenerin/epithelial sodium channel (DEG/ENaC) superfamily. The members of this family are amiloride-sensitive sodium channels that contain intracellular N and C termini, 2 hydrophobic transmembrane regions, and a large extracellular loop, which has many cysteine residues with conserved spacing. The member encoded by this gene may play a role in neurotransmission. In addition, a heteromeric association between this member and acid-sensing (proton-gated) ion channel 3 has been observed to co-assemble into proton-gated channels sensitive to gadolinium. Alternative splicing has been observed at this locus and two variants, encoding distinct isoforms, have been identified. [provided by RefSeq, Feb 2012]'
Locus ID 40

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.