Hyaluronan synthase 2 (HAS2) (NM_005328) Human 3' UTR Clone

CAT#: SC212271

3`UTR clone of hyaluronan synthase 2 (HAS2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HAS2
• Synonyms: MGC126241; MGC126242
• ACCN: NM_005328
• Insert Size: 1123 bp
• Sequence Data:
  Insert Sequence

  >SC212271 3'UTR clone of NM_005328
  The sequence shown below is from the reference sequence of NM_005328. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGGCGGAAGAAGGGACAACAATATGACATGGTGCTTGATGTATGATCTTCCATGTTTTGACGTTTGCAGT
  CACACACAACACCTTAGTTCCTCTAGGGGCTGTACAGTATTGTGGCATCAGATAATGCCACCAAAGGAGA
  CATATCACTGCTGCTGGGACTTGAACAAAGACATTTATATGGGTTTATTTTCATTCTGCCAAAGTAAAAC
  AATACATCAACAAGAAGAAACTCAGATTTAACCTGTTATTTCTATGAAAATGGGATGAATTCTTTGTTTA
  TGCACTTTTTCCTTACTGTGCATCCGCCTGAAAGTGTTTTGCCCTATATACCTCACTAGCCATGCTTTAT
  GTGGGTTATCATGGAAGAAAAGGATTTTGGAAACTCAAGGAAAAGTTCTTTCAACCTATACAACCTAACT
  TATGGACTGTTTTGATAGATGATAATTTTTTTTTTTTAGGAAGGATTTTCTTTTTAACTTTACCAAATGA
  AATGCCAAAGGAAGTTTTAAAGGCCGTTGGCTGTGCTGTATTTTGATATAATTGTACTGTGTTTTTAAAT
  TTTGTATGCCAATCTTAAAGACAAATTTTGCATATTCTCTATTTTACTTTTCTGCCAAAATAAACCTGTT
  CTTCCTTTTTTAAAATAAAATAAGTTCTTAAAAAATTTATACTTAAAAAATCCTGCCCAAAATGTGAAGC
  TTGGTTGACTGATGTTCATGATAGAAAGAATAAAATGTTTCTCTCTCTCTACCTTTTAAAATTGAATAGT
  TTATTTCTGTGAAAGAAGTATTTAAACTTTCAATATTTTAACTTTTTGTTTTTATTTCTTTTAGAAAAGG
  CCAATATACCTATCACACTTTGGAAGTAAAAATACACACTTTCGTGTGTACCTAAAAAAAAAATCGTTGA
  AAATCAAGGCCAAAGGTAGTGCAATTTTTTCATTAAGATTTAAAAAAAAGGGAATGATAGTCTTTGAAAG
  AAAACAGTAGGCATCCAGCACTGGACAAAACATGGGTATCAAAGATGAATAATCTTTGGAGATTCTGGCA
  GTGTTTTCCCAGAACAAGTCAAGTGGAAAGTGGAGAAATTATCTGTATAATTTTGGACACATACAATGCA
  GTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005328.2
• Summary: ' Hyaluronan or hyaluronic acid (HA) is a high molecular weight unbranched polysaccharide synthesized by a wide variety of organisms from bacteria to mammals, and is a constituent of the extracellular matrix. It consists of alternating glucuronic acid and N-acetylglucosamine residues that are linked by beta-1-3 and beta-1-4 glycosidic bonds. HA is synthesized by membrane-bound synthase at the inner surface of the plasma membrane, and the chains are extruded through pore-like structures into the extracellular space. It serves a variety of functions, including space filling, lubrication of joints, and provision of a matrix through which cells can migrate. HA is actively produced during wound healing and tissue repair to provide a framework for ingrowth of blood vessels and fibroblasts. Changes in the serum concentration of HA are associated with inflammatory and degenerative arthropathies such as rheumatoid arthritis. In addition, the interaction of HA with the leukocyte receptor CD44 is important in tissue-specific homing by leukocytes, and overexpression of HA receptors has been correlated with tumor metastasis. HAS2 is a member of the newly identified vertebrate gene family encoding putative hyaluronan synthases, and its amino acid sequence shows significant homology to glycosaminoglycan synthetase (DG42) from Xenopus laevis, and human and murine hyaluronan synthase 1. [provided by RefSeq, Jul 2008]'
• Locus ID: 3037