Csn1s2b (NM_009973) Mouse Untagged Clone

CAT#: MC200071

Csn1s2b (untagged) - Mouse casein alpha s2-like B (Csn1s2b), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Csn1s2b
• Synonyms: AW987150; Csnd; Csne
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC002084 sequence for NM_009973
  AGCTTGTCTTCAACTTAGGAAGCAAGGACTCATTAATCATGAAGTTCATCATTCTTACTTGCCTTTTGGC CGTTGCTCTTGCAAAGCAGAGGATGGAGCAATACATCTCCAGTGAGGAGTCCATGGATAACTCTCAAGAA AACTTTAAGCAGAATATGGATGTGGCCTTTTTTCCCAGTCAGGAAACTGTAGAGAACATTTACATTCCCC AAATGGAATCTGTTGAAGCTCCCATGAAGGTATCTGACATCATTTCTCAGCAACAATACAACCAGAAAAT GATGGACATGAGTGTGAGTGCCAGAGAGAAAACTGTGATGACTGAAGAAAGTAAGAACATCCAAGACTAC ATGAACAAAATGAAACGATACAGCAAGATCACCTGGCCACAGTTTGTAAAGCTTCTCCATCAATACCAGA AAACCATGACCCCGTGGAGCTATTACCCATCTACCCCCAGCCAGGTTTGAGTGGAAAATCCACATCTCCA TTTTCTTTTCTGCTGTAATTACTTCTCATTACCAACATATTGGGATAGATGTATAAATGATACAGAAGTG GTAAACCAACAGAATGCTCCAAAATAGTTCCAGAGTATCTTCTAGTCTTGTACATTTCCATTGAATGTGT TAGGTCTGCTTGTGGGTTTCATCTCTGCAGGGTTGATGACTATTGAGACTGTCTTCACTTCTGCTCCCAT GTCACTGAACCACATTCTTTTCAAAAAATAAAACTTCAAGTGCAAAAAAAAAAAAAAAAA
• Restriction Sites: RsrII-NotI
• ACCN: NM_009973
• ORF Size: 432 bp
• Insert Size: 432
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: BC002084, AAH02084
• RefSeq Size: 760
• RefSeq ORF: 432
• Locus ID: 12992
• Gene Summary: This gene is a member of the alpha-s2-like casein gene family, and this gene product is a calcium-sensitive casein. Members of this gene family are organized as a gene cluster that is conserved in its order, but with greater conservation amongst orthologs than paralogs. The protein encoded by this gene interacts with other casein proteins to form a micelle structure, and is a major source of protein in milk. This structure is important for the transport of calcium, phosphate, and protein. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).