Atp5d (NM_025313) Mouse Untagged Clone

CAT#: MC200271

Atp5d (untagged) - Mouse ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit (Atp5d), nuclear gene encoding mitochondrial protein, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Atp5d
• Synonyms: 0610008F14Rik; 1500000I11Rik; AA960090; AI876556; Atp5f1d; AU020773; C85518
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC008273 sequence for NM_025313
  CTCGCTTGCCCAGTGTGTCGGCCGCCCGCGAAGCTAGAGTCCACTGACTTTTCCGCCACCATGTTGCCCG CCTCACTGCTTCGTCACCCGGGCCTGCGCCGCCTGATGCTTCAGGCGCGTACATACGCCGAGGCCGCCGC TGCACCTGCCCCCGCCGCCGGGCCCGGACAGATGTCCTTCACCTTTGCCTCCCCGACGCAGGTGTTCTTT GACAGTGCCAACGTCAAGCAAGTGGACGTGCCTACGCTGACTGGAGCCTTTGGCATCTTGGCATCCCATG TCCCCACACTACAGGTCCTACGGCCTGGGCTGGTAGTGGTTCACACAGAAGACGGCACCACGACTAAGTA CTTTGTGAGCAGCGGCTCCGTCACTGTGAATGCCGACTCCTCTGTGCAGTTACTAGCTGAAGAAGCTGTG ACACTGGACATGCTGGACCTGGGGGCAGCCCGGGCCAACCTGGAGAAGGCGCAGTCAGAACTGTCAGGTG CGGCGGACGAGGCAGCACGGGCTGAGATCCAGATCCGTATTGAGGCCAATGAAGCCCTAGTGAAGGCCCT GGAGTAGGTGGTACCTACTGTCTGACACCCACGGGGAAACTGAGCCAGGTCCAGGCCGATGAGAAGTTCC CAGTGGGCTGAAGTGGCCACCAGGGGTCAGCAGTGCTCCAGTTGCTGGGCTTAAAGCTTCCTGGTGCCTG TCTGCCAGGTCATGGAGGATTCCCCAATCTGGCATCCCCACGATGCCTCTGGAGAGATGGCCTTGATTGC CCCTCAAAGCCACCTGAACCGTCGTCAACTTACCCAGCCTGTCTCCATTAAACACCAGGAACCAAAAAAA AAAAAAAAA
• Restriction Sites: RsrII-NotI
• ACCN: NM_025313
• ORF Size: 507 bp
• Insert Size: 507
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: BC008273, AAH08273
• RefSeq Size: 849
• RefSeq ORF: 507
• Locus ID: 66043
• Gene Summary: Mitochondrial membrane ATP synthase (F(1)F(0) ATP synthase or Complex V) produces ATP from ADP in the presence of a proton gradient across the membrane which is generated by electron transport complexes of the respiratory chain. F-type ATPases consist of two structural domains, F(1) - containing the extramembraneous catalytic core, and F(0) - containing the membrane proton channel, linked together by a central stalk and a peripheral stalk. During catalysis, ATP turnover in the catalytic domain of F(1) is coupled via a rotary mechanism of the central stalk subunits to proton translocation. Part of the complex F(1) domain and of the central stalk which is part of the complex rotary element. Rotation of the central stalk against the surrounding alpha(3)beta(3) subunits leads to hydrolysis of ATP in three separate catalytic sites on the beta subunits. [UniProtKB/Swiss-Prot Function]