Ndufa2 (NM_010885) Mouse Untagged Clone

CAT#: MC200552

Ndufa2 (untagged) - Mouse NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2 (Ndufa2), nuclear gene encoding mitochondrial protein, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ndufa2
• Synonyms: AV000592; B8; C1-B8; CI-B8
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC006815 sequence for NM_010885
  CAAAGATGGCGGCTGCCGCTGCTAGCCGAGCGGTCGGCGCAAAGCTGGGGTTGCGTGAGATTCGCGTTCA CTTATGCCAGCGTTCCCCAGGCAGCCAGGGTGTGAGGGATTTCATCGTGCAACGGTACGTGGAGCTGAAG AAGGCGCACCCCAACCTGCCCATTCTGATCCGCGAATGCTCGGAGGTGCAGCCCAAGCTTTGGGCCCGCT ATGCTTTTGGCCAAGAGAAGACGGTGTCTCTGAACAATCTGAGTGCTGATGAGGTAACCAGAGCCATGCA GAATGTGCTAAGCGGCAAAGCCTGAAGGTCTCCACTGAGGACTGTGAGCGAGAGCAGCTGAACCTGCTGG ACTGAAGACAGTGTGGGGAAATGTGTGCTTTGGGTCCTTATAAAGCTTACGCTGTACAGTGAAAAAAAAA AAAAAA
• Restriction Sites: RsrII-NotI
• ACCN: NM_010885
• ORF Size: 300 bp
• Insert Size: 300
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: BC006815, AAH06815
• RefSeq Size: 426
• RefSeq ORF: 300
• Locus ID: 17991
• Gene Summary: This gene encodes a subunit of the NADH-ubiquinone oxidoreductase (complex I) enzyme, which is a large, multimeric protein. It is the first enzyme complex in the mitochondrial electron transport chain and catalyzes the transfer of electrons from NADH to the electron acceptor ubiquinone. The proton gradient created by electron transfer drives the conversion of ADP to ATP. The human ortholog of this gene has been characterized, and its structure and redox potential is reported to be similar to that of thioredoxins. It may be involved in regulating complex I activity or assembly via assistance in redox processes. In humans, mutations in this gene are associated with Leigh syndrome, an early-onset progressive neurodegenerative disorder. A pseudogene of this gene is located on chromosome 5. [provided by RefSeq, May 2013]