Atpif1 (NM_007512) Mouse Untagged Clone

CAT#: MC200851

Atpif1 (untagged) - Mouse ATPase inhibitory factor 1 (Atpif1), nuclear gene encoding mitochondrial protein, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Atpif1
• Synonyms: ATP5IF1; Atpi; IF(1); If1
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC012680 sequence for NM_007512
  CCACGCGTCCGGTTCAGCCGCCCTCGCAGTTAGCGCGCTAGGAGAGAAGCAGCCACGCCCGCAACGCGAG CTGAGCAACGCCGAAGACAATGGCAGGCTCGGCGTTGGCAGTTCGGGCTCGGTTCGGTGTCTGGGGTATG AAGGTCCTGCAAACCCGAGGCTTCGTCTCGGACTCGTCGGATAGCATGGATACGGGCGCTGGCTCCATCC GAGAAGCTGGTGGAGCCTTCGGAAAACGAGAAAAGGCTGAAGAGGATCGGTACTTCCGAGAGAAGACTAA AGAACAGCTGGCTGCCCTGAGGAAACACCATGAAGATGAGATTGACCACCATTCGAAGGAGATAGAGCGT CTGCAGAAGCAAATTGAACGCCATAAGAAGAAGATCCAACAACTAAAGAATAATCATTGAATGCGCGCAG TCGGTCCCTCACAGAGTGGCCCGTATCACTCCCCACGTCTGTAGACACATGGCTTTGAATGATTACTATT TGGTCTGTGTGCTACTAACAGATAATAAACGATCACCAGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: RsrII-NotI
• ACCN: NM_007512
• ORF Size: 321 bp
• Insert Size: 321
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: BC012680, AAH12680
• RefSeq Size: 610
• RefSeq ORF: 321
• Locus ID: 11983
• Gene Summary: This gene encodes a member of the ATPase inhibitor family of proteins. This protein has been shown to negatively regulate the ATP hydrolysis activity of the F1Fo-ATPase. Knockdown of this gene is associated with reduced heme synthesis in differentiating erythroid cells. Misregulation of this gene has been found to lead to increased aerobic glycolysis in mouse cancer cells, while high expression levels of this gene have been correlated with gastric and liver cancer severity in human patients. A pseudogene of this gene has been identified. [provided by RefSeq, Apr 2015]