Apoa1 (BC012253) Mouse Untagged Clone

CAT#: MC201054

Apoa1 (untagged) - Mouse apolipoprotein A-I (cDNA clone MGC:18650 IMAGE:4195624), (10ug)


Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Apoa1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Apoa1
Synonyms Alp-1|Apoa-1|Brp-14|Ltw-1|Lvtw-1|Sep-1|Sep-2|Sep2|apo-AI|apoA-I
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC012253
GCTCCGGGGAGGTCACCCACACCCTTCAGGATGAAAGCTGTGGTGCTGGCCGTGGCTCTGGTCTTCCTGA CAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGACAAAGTGAAGGATTT CGCTAATGTGTATGTGGATGCGGTCAAAGACAGCGGCAGAGACTATGTGTCCCAGTTTGAATCCTCCTCC TTGGGCCAACAGCTGAACCTGAATCTCCTGGAAAACTGGGACACTCTGGGTTCAACCGTTAGTCAGCTGC AGGAACGGCTGGGCCCATTGACTCGGGACTTCTGGGATAACCTGGAGAAAGAAACAGATTGGGTGAGACA GGAGATGAACAAGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAA TGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGC GCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATTTCGCGACCGCATGCGCAC ACACGTAGACTCTCTGCGCACACAGCTAGCGCCCCACAGCGAACAGATGCGCGAGAGCCTGGCCCAGCGC CTGGCTGAGCTCAAGAGCAACCCTACCTTGAACGAGTACCACACCAGGGCCAAAACCCACCTGAAGACAC TTGGCGAGAAAGCCAGACCTGCGCTGGAGGACCTGCGCCATAGTCTGATGCCCATGCTGGAGACGCTTAA GACCAAAGCCCAGAGTGTGATCGACAAGGCCAGCGAGACTCTGACTGCCCAGTGAGGTGCCCGCTTCCAC TCCCCACCCCCGCATTGGCTTTCTTACAATAAACCTTTCCAAAATGGAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN BC012253
ORF Size 795 bp
Insert Size 795
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC012253, AAH12253
RefSeq Size 903
RefSeq ORF 795
Locus ID 11806
Gene Summary This gene encodes a preproprotein that is proteolytically cleaved to yield a signal peptide and a proproptein that is subsequently processed to generate the active mature peptide. The encoded protein is the major protein component of plasma high density lipoprotein (HDL). This protein facilitates the removal of cholesterol and other fats from tissues by transporting them to the liver for excretion. This protein is a cofactor for lecithin cholesterolacyltransferase, an enzyme that catalyzes the conversion of free cholesterol to cholesteryl esters. Mutations in this gene in humans causes familial HDL deficiency, Tangier disease and familial visceral amyloidosis. Similar clinical features are exhibited by mice with mutations in this gene. This gene is clustered with three other apolipoprotein genes on chromosome 9. [provided by RefSeq, Dec 2013]

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.