Txn1 (NM_011660) Mouse Untagged Clone

CAT#: MC201065

Txn1 (untagged) - Mouse thioredoxin 1 (Txn1), (10ug)


  "NM_011660" in other vectors (6)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Txn1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Txn1
Synonyms ADF; AW550880; Trx1; Txn
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC010756 sequence for NM_011660
CCATTTCCATCTGGTTCTGCTGAGACGCGTGTGGCTCCCTCCCCGCAACAGCCAAAATGGTGAAGCTGAT CGAGAGCAAGGAAGCTTTTCAGGAGGCCCTGGCCGCCGCGGGAGACAAGCTTGTCGTGGTGGACTTCTCT GCTACGTGGTGTGGACCTTGCAAAATGATCAAGCCCTTCTTCCATTCCCTCTGTGACAAGTATTCCAATG TGGTGTTCCTTGAAGTGGATGTGGATGACTGCCAGGATGTTGCTGCAGACTGTGAAGTCAAATGCATGCC GACCTTCCAGTTTTATAAAAAGGGTCAAAAGGTGGGGGAGTTCTCCGGTGCTAACAAGGAAAAGCTTGAA GCCTCTATTACTGAATATGCCTAATCATGCTCTGAAAAGTGTAACCAGCTACCAGCTGTTTAAAACCTGT ACCTTTTTTAATTTGCAAAAAACTATGAAGTGTGGAGAGTCTATACCCAACTGCCATCTGATTATAAATG ACAATAAAATATTAATTCTACCCTTTTAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_011660
ORF Size 318 bp
Insert Size 318
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Reference Data
RefSeq BC010756, AAH10756
RefSeq Size 534
RefSeq ORF 318
Locus ID 22166
Gene Summary ADF augments the expression of the interleukin-2 receptor TAC (IL2R/P55). [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.