Txn1 (NM_011660) Mouse Untagged Clone
CAT#: MC201065
Txn1 (untagged) - Mouse thioredoxin 1 (Txn1), (10ug)
"NM_011660" in other vectors (6)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Txn1 |
Synonyms | ADF; AW550880; Trx1; Txn |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC010756 sequence for NM_011660
CCATTTCCATCTGGTTCTGCTGAGACGCGTGTGGCTCCCTCCCCGCAACAGCCAAAATGGTGAAGCTGAT CGAGAGCAAGGAAGCTTTTCAGGAGGCCCTGGCCGCCGCGGGAGACAAGCTTGTCGTGGTGGACTTCTCT GCTACGTGGTGTGGACCTTGCAAAATGATCAAGCCCTTCTTCCATTCCCTCTGTGACAAGTATTCCAATG TGGTGTTCCTTGAAGTGGATGTGGATGACTGCCAGGATGTTGCTGCAGACTGTGAAGTCAAATGCATGCC GACCTTCCAGTTTTATAAAAAGGGTCAAAAGGTGGGGGAGTTCTCCGGTGCTAACAAGGAAAAGCTTGAA GCCTCTATTACTGAATATGCCTAATCATGCTCTGAAAAGTGTAACCAGCTACCAGCTGTTTAAAACCTGT ACCTTTTTTAATTTGCAAAAAACTATGAAGTGTGGAGAGTCTATACCCAACTGCCATCTGATTATAAATG ACAATAAAATATTAATTCTACCCTTTTAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_011660 |
ORF Size | 318 bp |
Insert Size | 318 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Reference Data | |
RefSeq | BC010756, AAH10756 |
RefSeq Size | 534 |
RefSeq ORF | 318 |
Locus ID | 22166 |
Gene Summary | ADF augments the expression of the interleukin-2 receptor TAC (IL2R/P55). [UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR200355 | Txn1 (Myc-DDK-tagged) - Mouse thioredoxin 1 (Txn1) |
USD 420.00 |
|
MG200355 | Txn1 (GFP-tagged) - Mouse thioredoxin 1 (Txn1) |
USD 460.00 |
|
MR200355L1 | Lenti ORF clone of Txn1 (Myc-DDK-tagged) - Mouse thioredoxin 1 (Txn1) |
USD 620.00 |
|
MR200355L2 | Lenti ORF clone of Txn1 (mGFP-tagged) - Mouse thioredoxin 1 (Txn1) |
USD 768.00 |
|
MR200355L3 | Lenti ORF clone of Txn1 (Myc-DDK-tagged) - Mouse thioredoxin 1 (Txn1) |
USD 620.00 |
|
MR200355L4 | Lenti ORF clone of Txn1 (mGFP-tagged) - Mouse thioredoxin 1 (Txn1) |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review