Atp5j (NM_016755) Mouse Untagged Clone

CAT#: MC201094

Atp5j (untagged) - Mouse ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F (Atp5j), nuclear gene encoding mitochondrial protein, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Atp5j
• Synonyms: Atp5pf; CF6
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC010766 sequence for NM_016755
  CGCTCCCCGCCAGCCCGCGTCCGCAACTCACCAGCTCCGGAATTCGTCCCGTGGCCCTAGCCCGCGCTTC CACAGCCGGCTGGGAACGGCGGCGGCGCGGGCTCCAGGTACAGCGCCTCTCCGGGCGAGCCGCGCCGCTC CCGCGAGTAGCAGGAGGCGTCCGGTCGCAGACTCCCTTCGAGGCGCTTCCTGTCCGGTGAGCGTCGAACG ACTGAAGCCGCGGCCCATAGTGCCTTGCGATGGCGGGTAGGCGTGTGTAGGCGGAGCCAGGGCCGGAAGT AGAACGGTGGCGGCGGCGGTGACTCTGGCAGCTCGGGACTCAGTGCAAGTACAGAGACTCAGCCATGGTT CTGCAGAGGATCTTCAGGCTCTCCTCTGTCCTTCGGTCAGCAGTCTCTGTGCATTTGAAGAGGAACATTG GTGTTACAGCTGTGGCCTTTAATAAGGAACTTGATCCTGTACAGAAACTCTTCGTGGACAAGATAAGAGA GTACAAATCAAAGCGACAGGCATCTGGAGGACCTGTTGATATTGGCCCAGAGTATCAGCAAGATCTGGAC AGAGAGCTTTATAAGCTTAAACAAATGTATGGTAAAGGAGAGATGGATACATTTCCTACCTTCAAATTTG ATGATCCCAAATTTGAAGTCATCGACAAACCCCAGTCCTGAGGAACATACAAAATCCATGTGGTAATTTG TCATGAATTAGTTGTACAACTAATCAAAAAATTCAAATAAACATTCATTTCACAGTTAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: RsrII-NotI
• ACCN: NM_016755
• ORF Size: 327 bp
• Insert Size: 327
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: BC010766, AAH10766
• RefSeq Size: 797
• RefSeq ORF: 327
• Locus ID: 11957
• Gene Summary: The protein encoded by this gene is a component of mitochondrial adenosine triphosphate synthase, which catalyzes the conversion of ATP from ADP. Mitochondrial adenosine triphosphate synthase consists of extrinsic and intrinsic membrane domains that are joined by a stalk. The protein encoded by this gene is a subunit of the stalk domain. A bi-directional promoter that drives expression of this gene has been has been identified. Pseudogenes of this gene are found on chromosomes 14 and 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3, 4, 5, 6 and 7 encode the same protein.