Cox7c (NM_007749) Mouse Untagged Clone

CAT#: MC201144

Cox7c (untagged) - Mouse cytochrome c oxidase, subunit VIIc (Cox7c), nuclear gene encoding mitochondrial protein, (10ug)


  "NM_007749" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Cox7c"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cox7c
Synonyms Cox7c1; COXVIIc
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC010772 sequence for NM_007749
CGCGCTCTGCAGAGCAAGGTCGTGTAGAAAGGGGAGTTAGGTGGTACGGCCATTTCTTCCGCCTTCCGTG TCTGCGGCCTTCGCAGAACTTCCAGCAGCGACATGTTGGGCCAGAGTATCCGGAGGTTCACGACCTCCGT GGTCCGTCGCAGCCACTATGAGGAGGGTCCGGGGAAGAATTTGCCATTTTCAGTGGAAAACAAGTGGCGG TTGCTGGCTATGATGACCGTGTACTTTGGATCTGGGTTTGCCGCACCTTTCTTTATAGTAAGACACCAGC TACTTAAAAAATAAGGATATTTAATTCATCCCTTTAACAGAATGAAGAAAGTTTAAGAGGTGATCTGAAA ATTGGATTAAACTCTTGAACTCTTATACTAGAAAAAATTGTAAATAAACTAATGACATAAAGAAAAAAAA AAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_007749
ORF Size 192 bp
Insert Size 192
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC010772, AAH10772
RefSeq Size 434
RefSeq ORF 192
Locus ID 12867
Gene Summary This protein is one of the nuclear-coded polypeptide chains of cytochrome c oxidase, the terminal oxidase in mitochondrial electron transport. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.