Cox7c (NM_007749) Mouse Untagged Clone
CAT#: MC201144
Cox7c (untagged) - Mouse cytochrome c oxidase, subunit VIIc (Cox7c), nuclear gene encoding mitochondrial protein, (10ug)
"NM_007749" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Cox7c |
Synonyms | Cox7c1; COXVIIc |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC010772 sequence for NM_007749
CGCGCTCTGCAGAGCAAGGTCGTGTAGAAAGGGGAGTTAGGTGGTACGGCCATTTCTTCCGCCTTCCGTG TCTGCGGCCTTCGCAGAACTTCCAGCAGCGACATGTTGGGCCAGAGTATCCGGAGGTTCACGACCTCCGT GGTCCGTCGCAGCCACTATGAGGAGGGTCCGGGGAAGAATTTGCCATTTTCAGTGGAAAACAAGTGGCGG TTGCTGGCTATGATGACCGTGTACTTTGGATCTGGGTTTGCCGCACCTTTCTTTATAGTAAGACACCAGC TACTTAAAAAATAAGGATATTTAATTCATCCCTTTAACAGAATGAAGAAAGTTTAAGAGGTGATCTGAAA ATTGGATTAAACTCTTGAACTCTTATACTAGAAAAAATTGTAAATAAACTAATGACATAAAGAAAAAAAA AAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_007749 |
ORF Size | 192 bp |
Insert Size | 192 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | BC010772, AAH10772 |
RefSeq Size | 434 |
RefSeq ORF | 192 |
Locus ID | 12867 |
Gene Summary | This protein is one of the nuclear-coded polypeptide chains of cytochrome c oxidase, the terminal oxidase in mitochondrial electron transport. [UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR200042 | Cox7c (Myc-DDK-tagged) - Mouse cytochrome c oxidase, subunit VIIc (Cox7c), nuclear gene encoding mitochondrial protein |
USD 68.00 |
|
MG200042 | Cox7c (GFP-tagged) - Mouse cytochrome c oxidase, subunit VIIc (Cox7c) |
USD 300.00 |
|
MR200042L3 | Lenti ORF clone of Cox7c (Myc-DDK-tagged) - Mouse cytochrome c oxidase, subunit VIIc (Cox7c), nuclear gene encoding mitochondrial protein |
USD 500.00 |
|
MR200042L4 | Lenti ORF clone of Cox7c (mGFP-tagged) - Mouse cytochrome c oxidase, subunit VIIc (Cox7c), nuclear gene encoding mitochondrial protein |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review