Myl6 (NM_010860) Mouse Untagged Clone
CAT#: MC201301
Myl6 (untagged) - Mouse myosin, light polypeptide 6, alkali, smooth muscle and non-muscle (Myl6), (10ug)
"NM_010860" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Myl6 |
Synonyms | ESMLC; LC17; LC17-GI; MLC-3; MLC1SM; Myln |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC026760 sequence for NM_010860
GCTCAGCAGCCAAGATGTGTGACTTCACCGAGGACCAGACCGCAGAATTCAAGGAGGCTTTCCAGCTGTT TGACCGAACAGGTGATGGCAAGATCCTGTACAGCCAGTGTGGGGATGTGATGCGGGCCCTGGGCCAGAAC CCTACCAACGCCGAGGTGCTCAAGGTCCTGGGGAACCCCAAGAGTGATGAGATGAATGTGAAGGTGCTGG ACTTTGAGCACTTCCTGCCCATGCTGCAGACCGTGGCCAAGAACAAGGACCAGGGAACCTACGAGGATTA TGTTGAAGGCCTTCGTGTGTTTGACAAGGAAGGAAATGGCACCGTCATGGGTGCTGAAATCCGTCATGTC CTAGTCACACTGGGCGAGAAGATGACAGAGGAAGAAGTAGAGATGCTAGTGGCGGGGCATGAGGACAGCA ATGGTTGCATCAACTATGAAGAGCTTGTCCGGATGGTGCTGAATGGCTGAGGACATTCTGTATCCCGAGT CTGTTCCTTGCCCAGTGTGATTTCTGTGTGGCTCCAGAGGCTCCCCTGTCACAGCACCTTGCCCATTTGG TTTCTTTTGGATGATGTTTGCCTTCCCCAAATAAAATTTGCTCTCTTTGCCCTCCAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_010860 |
ORF Size | 456 bp |
Insert Size | 456 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | BC026760, AAH26760 |
RefSeq Size | 657 |
RefSeq ORF | 456 |
Locus ID | 17904 |
Gene Summary | Regulatory light chain of myosin. Does not bind calcium. [UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) lacks an alternate exon in the 3' coding region, resulting in a frameshift and a novel 3' UTR, compared to variant 1. The encoded isoform (MLC3sm, also known as LC17B and LC17-sm) has a distinct C-terminus and is shorter than isoform a. Isoform MLC3sm and MLC3nm are the same length but differ in their C-termini. Isoforms b and c are the same length but differ in their C-termini. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR201079 | Myl6 (Myc-DDK-tagged) - Mouse myosin, light polypeptide 6, alkali, smooth muscle and non-muscle (Myl6) |
USD 68.00 |
|
MG201079 | Myl6 (GFP-tagged) - Mouse myosin, light polypeptide 6, alkali, smooth muscle and non-muscle (Myl6) |
USD 300.00 |
|
MR201079L3 | Lenti ORF clone of Myl6 (Myc-DDK-tagged) - Mouse myosin, light polypeptide 6, alkali, smooth muscle and non-muscle (Myl6) |
USD 500.00 |
|
MR201079L4 | Lenti ORF clone of Myl6 (mGFP-tagged) - Mouse myosin, light polypeptide 6, alkali, smooth muscle and non-muscle (Myl6) |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review