Myl6 (NM_010860) Mouse Untagged Clone

CAT#: MC201301

Myl6 (untagged) - Mouse myosin, light polypeptide 6, alkali, smooth muscle and non-muscle (Myl6), (10ug)


  "NM_010860" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Myl6"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Myl6
Synonyms ESMLC; LC17; LC17-GI; MLC-3; MLC1SM; Myln
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC026760 sequence for NM_010860
GCTCAGCAGCCAAGATGTGTGACTTCACCGAGGACCAGACCGCAGAATTCAAGGAGGCTTTCCAGCTGTT TGACCGAACAGGTGATGGCAAGATCCTGTACAGCCAGTGTGGGGATGTGATGCGGGCCCTGGGCCAGAAC CCTACCAACGCCGAGGTGCTCAAGGTCCTGGGGAACCCCAAGAGTGATGAGATGAATGTGAAGGTGCTGG ACTTTGAGCACTTCCTGCCCATGCTGCAGACCGTGGCCAAGAACAAGGACCAGGGAACCTACGAGGATTA TGTTGAAGGCCTTCGTGTGTTTGACAAGGAAGGAAATGGCACCGTCATGGGTGCTGAAATCCGTCATGTC CTAGTCACACTGGGCGAGAAGATGACAGAGGAAGAAGTAGAGATGCTAGTGGCGGGGCATGAGGACAGCA ATGGTTGCATCAACTATGAAGAGCTTGTCCGGATGGTGCTGAATGGCTGAGGACATTCTGTATCCCGAGT CTGTTCCTTGCCCAGTGTGATTTCTGTGTGGCTCCAGAGGCTCCCCTGTCACAGCACCTTGCCCATTTGG TTTCTTTTGGATGATGTTTGCCTTCCCCAAATAAAATTTGCTCTCTTTGCCCTCCAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_010860
ORF Size 456 bp
Insert Size 456
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC026760, AAH26760
RefSeq Size 657
RefSeq ORF 456
Locus ID 17904
Gene Summary Regulatory light chain of myosin. Does not bind calcium. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) lacks an alternate exon in the 3' coding region, resulting in a frameshift and a novel 3' UTR, compared to variant 1. The encoded isoform (MLC3sm, also known as LC17B and LC17-sm) has a distinct C-terminus and is shorter than isoform a. Isoform MLC3sm and MLC3nm are the same length but differ in their C-termini. Isoforms b and c are the same length but differ in their C-termini.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.