Romo1 (NM_025946) Mouse Untagged Clone

CAT#: MC201344

Romo1 (untagged) - Mouse reactive oxygen species modulator 1 (Romo1), nuclear gene encoding mitochondrial protein, (10ug)


  "NM_025946" in other vectors (5)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Romo1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Romo1
Synonyms 2010100O12Rik; AI853864
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC028749 sequence for NM_025946
GAGCGATCGCAGCGGAGAACGAGATGCCGGTGGCCGTGGGTCCCTACGGGCAGTCCCAGCCCAGCTGCTT CGACCGCGTGAAGATGGGCTTCGTCATGGGTTGCGCAGTGGGTATGGCGGCCGGGGCGCTGTTCGGCACC TTCTCCTGTCTCAGGATCGGAATGCGGGGTCGGGAGCTAATGGGCGGCATTGGGAAAACCATGATGCAGA GTGGCGGCACGTTTGGCACTTTCATGGCCATTGGAATGGGCATACGATGCTAATTAGGGCTAGGATGCCC TGCAATACCTAAACTTCCCCATCCATTTCGACCCTTGTACAATAATAAAGTTGTTTTCTTCTCGTTAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites EcoRI-NotI     
ACCN NM_025946
ORF Size 240 bp
Insert Size 240
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC028749, AAH28749
RefSeq Size 382
RefSeq ORF 240
Locus ID 67067

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.