Nqo2 (NM_020282) Mouse Untagged Clone

CAT#: MC201352

Nqo2 (untagged) - Mouse NAD(P)H dehydrogenase, quinone 2 (Nqo2), transcript variant 1, (10ug)


  "NM_020282" in other vectors (5)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Nqo2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Nqo2
Synonyms NMO2; Nmor2; Ox2
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC027629 sequence for NM_020282
TAGACACTGGCTGTGTCACATTGTGCGTGTGTTCCCTCCAGGAGGCAGAGGTCCCTGGCTGCATCACCAG CCACTCACTTCAAACCAGAGCCCAGCTAAATAACCTTTCTTGCTGTTTCTTGAACTCTCCAGAGTGCTAC AATAACCAAGGAGAGTAACAGTACCTGAAACTTTTGGCTGTTATACCAAATCAGAGAATCTATCTCCTCC AACATGGCAGGTAAGAAAGTGCTCATCGTCTATGCACACCAAGAACCCAAGTCCTTCAATGGGTCCCTGA AGAAAGTGGCTGTTGAAGAACTGAGCAAGCAGGGATGCACAGTCACTGTGTCTGATTTATATAGCATGAA CTTTGAGCCAAGGGCCACAAGAAATGATATCACTGGTGCCCCCTCTAATCCTGACGTCTTCAGTTATGGG ATAGAAACCCATGAAGCCTACAAGAAGAAAGCTCTGACCAGTGATATATTTGAAGAACAGAGAAAGGTGC AAGAAGCTGATCTTGTGATATTTCAGTTTCCACTATACTGGTTCAGCGTTCCAGCAATCCTAAAAGGTTG GATGGATAGGGTGCTGTGCCGAGGGTTTGCCTTTGATATCCCAGGCTTTTATGACTCTGGTTTTCTCAAG GGTAAATTAGCTCTCCTTTCCTTAACCACGGGAGGTACAGCGGAGATGTACACAAAAGATGGGGTCAGTG GAGATTTCCGGTACTTCCTGTGGCCACTTCAGCATGGTACACTGCACTTCTGTGGATTTAAAGTCCTTGC CCCCCAGATCAGTTTTGGTCTTGATGTTTCATCAGAAGAAGAAAGGAAAGTGATGCTGGCATCATGGGCC CAGCGGCTGAAGAGCATCTGGAAGGAAGAACCCATCCACTGCACACCCCCTTGGTACTTCCAAGAGTAAC ATTTTGTGCTCTGAGTACAGCTGACAAGCAACACAGTGAGAGACCTACAGCATGTGCAAAGAGAAGGTGG TGTTGTATCCTGAGATGTATTTAACAGTGCCCACCAATGAGTGTCTTCAGTTTAATACAACTAGTTCAGA TATTTCAAAAGTCAAAAAAAAAAAAAAAAAAAA
Restriction Sites EcoRI-NotI     
ACCN NM_020282
ORF Size 696 bp
Insert Size 696
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Reference Data
RefSeq BC027629, AAH27629
RefSeq Size 1083
RefSeq ORF 696
Locus ID 18105
Gene Summary The enzyme apparently serves as a quinone reductase in connection with conjugation reactions of hydroquinones involved in detoxification pathways as well as in biosynthetic processes such as the vitamin K-dependent gamma-carboxylation of glutamate residues in prothrombin synthesis. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). Variants 1, 2 and 3 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.