Iapp (NM_010491) Mouse Untagged Clone

CAT#: MC201355

Iapp (untagged) - Mouse islet amyloid polypeptide (Iapp), (10ug)


  "NM_010491" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Iapp"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Iapp
Synonyms DAP
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC027527 sequence for NM_010491
CTGAAGCTTCAGGCTGTCAAAGCATTTTCTGATATTGCTGCCTCGGACCACTGAAAGGGATCTTGAGAAA TGATGTGCATCTCCAAACTGCCAGCTGTCCTCCTCATCCTCTCTGTGGCACTGAACCACTTGAGAGCTAC ACCTGTCAGAAGTGGTAGCAACCCTCAGATGGACAAACGGAAGTGCAACACGGCCACGTGTGCCACACAA CGCCTGGCAAACTTTTTGGTTCGTTCCAGCAACAACCTTGGTCCAGTCCTCCCACCAACCAACGTGGGAT CGAATACATATGGCAAGAGGAATGCGGCAGGGGATCCAAATAGGGAATCCTTGGATTTCTTACTCGTTTA AAGTCAATGTACTTCTGCAGCACTTAATACTTTATGTGTAAATGCTCTGGTGATTTCCTGAATATTAACA GTACCTTTTTCATTCCCCCCTCAGTGAGAATGCACAATGTGCTTGTGCTTGATGACTGTGTGTGTAAATT CTCATGCTAAGAATTGCTTTAAACTGAGTATTGATCAAGTTCAGAGTGAAGTCAATGTCTCTAATCACAC ATGTTCTTGCTATACATTTATATTTTAGGGACACTTAAAATTTCTGTTTTTACCTTGTACCTCTATGACT CAAGTTTAACAATAAAGAAGACCATGGGATGATGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAA
Restriction Sites EcoRI-NotI     
ACCN NM_010491
ORF Size 282 bp
Insert Size 282
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Reference Data
RefSeq BC027527, AAH27527
RefSeq Size 715
RefSeq ORF 282
Locus ID 15874
Gene Summary Selectively inhibits insulin-stimulated glucose utilization and glycogen deposition in muscle, while not affecting adipocyte glucose metabolism. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.