Cd52 (NM_013706) Mouse Untagged Clone

CAT#: MC201359

Cd52 (untagged) - Mouse CD52 antigen (Cd52), (10ug)


  "NM_013706" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Cd52"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cd52
Synonyms AI463198; B7; B7-Ag; CAMPATH-1; CLS1; MB7
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC027495 sequence for NM_013706
ATCTCTCAAAGCTGCTACAGAGCCCAGGAAGATTTCAGGATGAAGAGCTTCCTCCTCTTCCTCACTATCA TTCTTCTGGTTGTGATTCAGATACAAACAGGATCCTTGGGACAAGCCACTACGGCCGCTTCTGGTACTAA CAAAAACAGCACCTCCACCAAAAAAACCCCCTTAAAGAGTGGGGCCTCATCCATCATCGATGCGGGTGCC TGCAGTTTCCTCTTCTTTGCCAATACCTTAATGTGCCTCTTCTACCTCAGCTGAGGTGAAGGCGCAGCTT CTGAAGCCCCGTGCTCCACCCACTGCTGCCACCATCAGTAGCGAGAGACATCCCAACCCACGGGAAGGGT TGATAGCAGATATCCAAGGAGGCTAAAGTTGACAGCCAATGGCCGGAATGGGAGCGGGGCCGTGACACCC AGCTAGGGCACAATAAAGTTATACTTATGCTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites EcoRI-NotI     
ACCN NM_013706
ORF Size 225 bp
Insert Size 225
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC027495, AAH27495
RefSeq Size 481
RefSeq ORF 225
Locus ID 23833
Gene Summary May play a role in carrying and orienting carbohydrate, as well as having a more specific role. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.