Ubl5 (NM_025401) Mouse Untagged Clone

CAT#: MC201361

Ubl5 (untagged) - Mouse ubiquitin-like 5 (Ubl5), (10ug)


  "NM_025401" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Ubl5"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ubl5
Synonyms 1110030M22Rik; beacon
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC028498 sequence for NM_025401
GCTCGAGCTACGAGTTGTGTCGTCGATAGGTTCGAGGATATTGGAGCTCCAGCCACAATGATTGAGGTGG TTTGCAACGACCGTCTCGGAAAGAAAGTCCGCGTTAAGTGCAACACCGATGACACCATCGGCGACTTGAA GAAACTGATAGCTGCTCAAACTGGCACCCGCTGGAACAAGATCGTTCTTAAAAAGTGGTACACGATTTTT AAGGACCACGTGTCTCTGGGAGATTATGAAATCCACGATGGGATGAACCTGGAGCTTTATTACCAGTAGA GGGGGATTCCTTCTCCTCCTCGCCCTGCTCTGCCCTGCCCTCCTCTCCCATCCTCATCTGACACTGGTGT AGATGGTCATTTTTAACAGTTCACATGAATAAAAACTTGGCTGCTGAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites EcoRI-NotI     
ACCN NM_025401
ORF Size 222 bp
Insert Size 222
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC028498, AAH28498
RefSeq Size 418
RefSeq ORF 222
Locus ID 66177

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.