Cela2a (NM_007919) Mouse Untagged Clone

CAT#: MC201774

Cela2a (untagged) - Mouse chymotrypsin-like elastase family, member 2A (Cela2a), (10ug)


  "NM_007919" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Cela2a"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cela2a
Synonyms Ela-2; Ela2; Ela2a
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC026552 sequence for NM_007919
GGGACACACCATGATCAGGACACTGCTGCTATCTGCCTTGGTGGCTGGAGCCCTCAGCTGTGGGTACCCC ACTTATGAGGTGGAGGATGATGTGAGCAGGGTAGTTGGGGGTCAAGAGGCCACACCCAACACCTGGCCCT GGCAGGTCTCCCTGCAGGTCCTTTCCTCCGGAAGGTGGCGCCACAACTGCGGAGGCTCCCTGGTGGCCAA CAACTGGGTTCTGACAGCTGCCCATTGCCTCAGCAACTATCAGACCTACCGAGTGCTGCTGGGCGCACAC AGCCTCTCCAACCCCGGAGCTGGCTCTGCTGCTGTTCAAGTCTCTAAGCTTGTGGTCCACCAGAGGTGGA ACTCCCAAAACGTCGGCAATGGCTATGACATTGCCTTAATCAAACTGGCCAGCCCAGTGACCCTGAGCAA GAACATCCAGACAGCTTGCCTCCCACCCGCTGGCACCATTCTCCCGAGAAACTATGTCTGCTATGTCACA GGCTGGGGCCTGCTGCAGACCAATGGGAACAGTCCTGACACCCTGAGGCAGGGCCGCCTGCTGGTTGTGG ACTATGCCACCTGCTCCAGCGCTAGCTGGTGGGGAAGCTCTGTGAAGTCCAGCATGGTGTGCGCTGGTGG CGACGGCGTGACCTCCAGCTGCAATGGGGACTCTGGCGGACCACTGAATTGCCGGGCATCTAATGGCCAG TGGCAGGTGCATGGCATCGTGAGCTTCGGCTCCTCTCTGGGCTGCAACTACCCCCGCAAGCCATCCGTCT TCACCAGGGTCTCCAACTACATTGACTGGATCAACTCGGTGATGGCAAGGAACTAACTGAAGACATTACT GCCACTGTCCCCCTGGAAATGCCATAGAAAAGAAATAGTAATAAAGTAATTTAAGAATCACAAAAAAAAA AAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_007919
ORF Size 816 bp
Insert Size 816
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Reference Data
RefSeq BC026552, AAH26552
RefSeq Size 917
RefSeq ORF 816
Locus ID 13706
Gene Summary This gene encodes a serine protease enzyme that hydrolyzes elastin. This gene is highly expressed in the pancreatic acinar cells where the encoded preproprotein undergoes processing including signal peptide cleavage to generate an inactive zymogen. The removal of N-terminal activation peptide from the zymogen by trypsin generates active elastase enzyme. This gene is also expressed in the mouse epidermis where it participates in pro-filaggrin processing. [provided by RefSeq, Jul 2016]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.