Gng2 (NM_010315) Mouse Untagged Clone
CAT#: MC201787
Gng2 (untagged) - Mouse guanine nucleotide binding protein (G protein), gamma 2 (Gng2), transcript variant 1, (10ug)
Product Images
Other products for "Gng2"
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Gng2 |
Synonyms | 82 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC021599 sequence for NM_010315
GAGCCAAGCAAGTCAGATCTGCCAGGGAGCGTCAGGCCTTGAACACTGACCAGAGTCTCTGAAGACCCCA TCCAACGCTCCAATGGCCAGCAACAACACCGCCAGCATAGCACAAGCCAGGAAGCTGGTAGAACAGCTGA AGATGGAAGCCAACATCGACAGGATAAAGGTGTCCAAGGCAGCTGCTGACTTGATGGCCTACTGTGAGGC ACATGCCAAGGAAGACCCTCTGCTGACCCCAGTCCCAGCCTCAGAAAACCCCTTTCGGGAGAAGAAGTTC TTCTGCGCCATCCTTTAAGTCTCTGAGAGGAGGCTGAAGAGTGTTGGGGCTCCTGGGACATACATGTAGA GTTCCTAGCAAAGTGGGCGCCTTTCTCGTCCACAGCATTTAAAGAGAGGAAGGAGAACCATCCTGGACAC TCCGGGCTGTGCATGTTTAAAGAAATGTCCCCTTATGAGAATGAAAGCTGATTCCGTGTCCCAACTTTAG AGATCTGACCCTGCAGACCGGCCTGGAGGAGGGAAATGTATAAAAAATGAGAATGGTAATCACTTCTTTT CTGCTGTCCCTCTAAGACATTTCTGCTTCATATTTATAAACAAAATAAACATTAAAGCCGGTGTCCTGAG CTGAGAAAAAAAAAAAAAAAAAAG |
Restriction Sites | RsrII-NotI |
ACCN | NM_010315 |
ORF Size | 216 bp |
Insert Size | 216 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | BC021599, AAH21599 |
RefSeq Size | 654 |
RefSeq ORF | 216 |
Locus ID | 14702 |
Gene Summary | Guanine nucleotide-binding proteins (G proteins) are involved as a modulator or transducer in various transmembrane signaling systems. The beta and gamma chains are required for the GTPase activity, for replacement of GDP by GTP, and for G protein-effector interaction. [UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript. Variants 1-6 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.