Usmg5 (NM_023211) Mouse Untagged Clone

CAT#: MC201843

Usmg5 (untagged) - Mouse upregulated during skeletal muscle growth 5 (Usmg5), (10ug)


  "NM_023211" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Usmg5"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Usmg5
Synonyms 2010301L15Rik; Usmg5
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC024355 sequence for NM_023211
CCCACGCGTCCGCGAGGGCCGAGTCGTCGCGGCCTGTCGGTCGCGTGCGGGGAGGGGGCGTCTTCCGGTC GGGCCGAGCTAGTCGCTAGGTTTGTTGAAGGACATCGGCCGCCGAGTTTGGGGTTCGGACGAAGATTGAC GTCATGGCTGGTGCAGAAAGTGATGGCCAATTCCAGTTCACTGGTATTAAAAAATATTTCAACTCTTATA CCCTCACAGGTAGAATGAATTGTGTCCTGGCCACATATGGAGGCATTGCTTTGCTGGTCTTATACTTCAA GTTAAGGCCTAAGAAAACTCCAGCTGTGAAAGCAACATAAATGGATTTTGAAATGTCTGACCTCACCTGT TAAGTCCCATGCCTGAAGAAGCTGATGTGAACTCATCATGTAATACTCAATTTGTACAATAAATTATGAA CCTGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_023211
ORF Size 315 bp
Insert Size 315
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC024355
RefSeq Size 475
RefSeq ORF 315
Locus ID 66477

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.