Hspe1 (NM_008303) Mouse Untagged Clone

CAT#: MC201854

Hspe1 (untagged) - Mouse heat shock protein 1 (chaperonin 10) (Hspe1), nuclear gene encoding mitochondrial protein, (10ug)


  "NM_008303" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Hspe1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Hspe1
Synonyms 10kDa; Hsp10; mt-cpn10
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC024385 sequence for NM_008303
GTGGCGGCGAAGGCGAGAGTCATGGCTGGACAAGCTTTTAGGAAGTTTCTTCCGCTCTTTGACAGAGTAT TGGTTGAAAGGAGTGCTGCCGAAACTGTAACCAAAGGTGGCATTATGCTTCCAGAAAAGTCTCAAGGAAA AGTGTTGCAAGCAACGGTCGTGGCTGTGGGGTCAGGAGGGAAAGGAAAGAGTGGAGAGATTGAGCCTGTC AGTGTGAAAGTTGGAGATAAAGTTCTTCTCCCAGAATATGGAGGCACCAAAGTAGTTCTAGATGACAAGG ATTATTTCTTATTTAGAGATAGTGACATTCTTGGAAAGTATGTCGACTGAAATCACTGTTGAAATGGTGT CACGTGAAGCTGCCATTCCACTGATGTCTGAACTATTTCATCATGTAAATAATTTCCATGCCTCCCTTTT ATAATAAACAGATGATGCCTAAACTGACAGCCATTGTCTCTGACCTTTAGTTTCACTGTACTGTTACAAA CATTTCCAAATAAAATGATGTAAATGAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_008303
ORF Size 309 bp
Insert Size 309
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC024385, AAH24385
RefSeq Size 534
RefSeq ORF 309
Locus ID 15528
Gene Summary Eukaryotic CPN10 homolog which is essential for mitochondrial protein biogenesis, together with CPN60. Binds to CPN60 in the presence of Mg-ATP and suppresses the ATPase activity of the latter. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.