Praf2 (NM_138602) Mouse Untagged Clone

CAT#: MC201916

Praf2 (untagged) - Mouse PRA1 domain family 2 (Praf2), (10ug)


  "NM_138602" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Praf2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Praf2
Synonyms AA986329; C78013; DXImx39e; JM4; Sfc20
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_138602, the custom clone sequence may differ by one or more nucleotides


ATGTCGGAGGTGCGGCTGCCACCGCTGCGCGCCCTAGACGACTTTGTCCTGGGGTCTGCGCGCCTGGCGG
CTCCTGATCCAGGCGATCCACAACGATGGTGTCACCGCGTCATCAACAACCTCCTCTACTACCAAACCAA
TTACCTTCTCTGCTTTGGCATCAGTCTTGCGCTGGCCGGGTACATTCGTCCGCTGCACACCCTCCTGAGT
GCACTGGTAGTGGTGGTGGCCCTCGGGGTGCTGGTGTGGGCTGCTGAAACCCGTGCAGCTGTGCGCCGCT
GCCGTCGCAGCCACCCTGCTGCCTGCCTGGCTGCAGTGCTTGCCATTAGCCTCTTCATTCTCTGGGCCGT
GGGTGGCGCCTTCACCTTCCTGCTCAGCATCACAGCGCCTGTGTTTTTGATCCTGCTGCATGCTTCACTG
CGTCTGAGAAACCTTAAAAACAAGATTGAGAACAAGATCGAGAGCATCGGTCTAAAGCGGACACCAATGG
GATTGCTTCTAGAGGCACTGGGACAGGAGCAGGAAGCTGGATCCTAG


Restriction Sites RsrII-NotI     
ACCN NM_138602
ORF Size 537 bp
Insert Size 537
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC064757, AAH64757
RefSeq Size 1248
RefSeq ORF 537
Locus ID 54637

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.