Avp (NM_009732) Mouse Untagged Clone

CAT#: MC202013

Avp (untagged) - Mouse arginine vasopressin (Avp), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Avp
• Synonyms: Vp; Vsp
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC051997 sequence for NM_009732
  ACAGTGCCCACCTATGCTCGCCAGGATGCTCAACACTACGCTCTCCGCTTGTTTCCTGAGCCTGCTGGCC TTCTCCTCCGCCTGCTACTTCCAGAACTGCCCAAGAGGCGGCAAGAGGGCCATCTCTGACATGGAGCTGA GACAGTGTCTCCCCTGCGGCCCGGGCGGCAAAGGACGCTGCTTCGGACCAAGCATCTGCTGCGCGGACGA GCTGGGCTGCTTCGTGGGCACCGCCGAGGCGCTGCGCTGCCAGGAGGAGAACTACCTGCCCTCGCCCTGC CAGTCCGGCCAGAAGCCCTGCGGGAGCGGGGGCCGCTGCGCCGCCGTGGGCATCTGCTGCAGCGACGAGA GCTGCGTGGCCGAGCCCGAGTGCCACGACGGTTTTTTCCGCCTCACCCGCGCTCGGGAGCCAAGCAACGC CACACAGCTGGACGGCCCTGCTCGGGCGCTGCTGCTAAGGCTGGTACAGCTGGCTGGGACACGGGAGTCC GTGGATTCTGCCAAGCCCCGGGTCTACTGAGCCATCGCCCCCACGCCTCGCCCCTACAGCATGGAAAATA AACTTTTAAAAACTGCAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: AscI-NotI
• ACCN: NM_009732
• ORF Size: 507 bp
• Insert Size: 507
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: BC051997, AAH51997
• RefSeq Size: 597
• RefSeq ORF: 507
• Locus ID: 11998
• Gene Summary: This gene encodes a member of the vasopressin/oxytocin family and preproprotein that is proteolytically processed to generate multiple protein products. These products include the neuropeptide hormone arginine vasopressin, and two other peptides, neurophysin 2 and copeptin. Arginine vasopressin binds to vasopressin receptors and functions as a vasopressor, to constrict blood vessels and increase blood pressure, and as an antidiuretic, to reduce the production of urine. Neurophysin 2 functions as a carrier protein in the transport of arginine vasopressin. This gene is present in a gene cluster with the related gene oxytocin on chromosome 2. [provided by RefSeq, Aug 2015]