Rpl39 (NM_026055) Mouse Untagged Clone

CAT#: MC202087

Rpl39 (untagged) - Mouse ribosomal protein L39 (Rpl39), (10ug)


  "NM_026055" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Rpl39"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Rpl39
Synonyms 2810465O16Rik
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC039092 sequence for NM_026055
CGTGCGCGCTATTCTTGATTCGGCTTCTCGCCATGTCTTCTCACAAGACTTTCCGAATCAAGCGATTCCT GGCCAAGAAACAAAAGCAAAATCGCCCTATTCCTCAGTGGATCCGGATGAAAACTGGTAACAAAATCAGG TACAACTCTAAGAGAAGACACTGGAGGAGAACGAAGCTGGGTCTGTAAGGATTCACACAATGGCAAGACT GAGGATTTATACTGAATTGTCATCAATCAGTCCTACCAGATGGATTTCAACATTTAAACCTGGAGACTCT TCGTGTCTTGAATTAGGATGTTTGTCCAGTAATAAAATATAGAACCTTTCAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_026055
ORF Size 156 bp
Insert Size 156
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC039092, AAH39092
RefSeq Size 345
RefSeq ORF 156
Locus ID 67248

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.