Rpl39 (NM_026055) Mouse Untagged Clone
CAT#: MC202087
Rpl39 (untagged) - Mouse ribosomal protein L39 (Rpl39), (10ug)
"NM_026055" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Rpl39 |
Synonyms | 2810465O16Rik |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC039092 sequence for NM_026055
CGTGCGCGCTATTCTTGATTCGGCTTCTCGCCATGTCTTCTCACAAGACTTTCCGAATCAAGCGATTCCT GGCCAAGAAACAAAAGCAAAATCGCCCTATTCCTCAGTGGATCCGGATGAAAACTGGTAACAAAATCAGG TACAACTCTAAGAGAAGACACTGGAGGAGAACGAAGCTGGGTCTGTAAGGATTCACACAATGGCAAGACT GAGGATTTATACTGAATTGTCATCAATCAGTCCTACCAGATGGATTTCAACATTTAAACCTGGAGACTCT TCGTGTCTTGAATTAGGATGTTTGTCCAGTAATAAAATATAGAACCTTTCAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_026055 |
ORF Size | 156 bp |
Insert Size | 156 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | BC039092, AAH39092 |
RefSeq Size | 345 |
RefSeq ORF | 156 |
Locus ID | 67248 |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR200015 | Rpl39 (Myc-DDK-tagged) - Mouse ribosomal protein L39 (Rpl39) |
USD 68.00 |
|
MG200015 | Rpl39 (GFP-tagged) - Mouse ribosomal protein L39 (Rpl39) |
USD 300.00 |
|
MR200015L3 | Lenti ORF clone of Rpl39 (Myc-DDK-tagged) - Mouse ribosomal protein L39 (Rpl39) |
USD 500.00 |
|
MR200015L4 | Lenti ORF clone of Rpl39 (mGFP-tagged) - Mouse ribosomal protein L39 (Rpl39) |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review