Guca2b (NM_008191) Mouse Untagged Clone
CAT#: MC202104
Guca2b (untagged) - Mouse guanylate cyclase activator 2b (retina) (Guca2b), (10ug)
"NM_008191" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Guca2b |
Synonyms | AV066530; Gcap2; Ugn |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC024373 sequence for NM_008191
CCCACGCGTCCGCCCACGCGTCCGGGAACCCAGAGGTGTGAGCTTGGAAGCGAGGCCATGTCAAGAAGCC AACTGTGGGCTGCCGTCGTCCTGCTGCTGCTCCTGCAGAGTGCACAGGGTGTCTACATCAAGTACCATGG CTTCCAAGTCCAGCTGGAATCAGTGAAGAAGCTGAATGAGTTGGAGGAGAAGGAGATGTCCAATCCCCAG CCGCGGAGAAGTGGCCTCCTCCCTGCTGTGTGCCATAACCCAGCCTTGCCCTTGGACCTCCAGCCTGTTT GTGCCTCCCAGGAAGCTGCCAGCACCTTCAAGGCCTTGAGGACCATCGCCACCGACGAATGTGAACTGTG TATAAATGTTGCCTGTACAGGCTGCTGATGAAATGACTCTGGGTCTTAAGACCACTCCGGACACTTTCCC CACAGCCCAACCTGTCCATACTTAGGCACCATTGAAGTAATCGCCATCCTCCCAGCATAAATGGATCCTT AGCAAGGCAATATGGATGCAGAGTTGCCATATTTGGCCCCCAGGCAGCTGCACCTGAATAAAAAATGCTA CCCCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_008191 |
ORF Size | 321 bp |
Insert Size | 321 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | BC024373, AAH24373 |
RefSeq Size | 605 |
RefSeq ORF | 321 |
Locus ID | 14916 |
Gene Summary | This gene encodes a member of the guanylin family and preproprotein that is proteolytically processed to generate a mature protein product. The mature protein product, known as uroguanylin, is an endogenous ligand for the guanylate cyclase-C receptor and may regulate salt and water homeostasis in the intestine and kidneys. Homozygous knockout mice for this gene exhibit impaired sodium chloride excretion and elevated arterial pressure. This gene is present in a gene cluster with a related guanylin family member on chromosome 4. [provided by RefSeq, Sep 2015] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR200368 | Guca2b (Myc-DDK-tagged) - Mouse guanylate cyclase activator 2b (retina) (Guca2b) |
USD 68.00 |
|
MG200368 | Guca2b (GFP-tagged) - Mouse guanylate cyclase activator 2b (retina) (Guca2b) |
USD 300.00 |
|
MR200368L3 | Lenti ORF clone of Guca2b (Myc-DDK-tagged) - Mouse guanylate cyclase activator 2b (retina) (Guca2b) |
USD 500.00 |
|
MR200368L4 | Lenti ORF clone of Guca2b (mGFP-tagged) - Mouse guanylate cyclase activator 2b (retina) (Guca2b) |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review