Guca2b (NM_008191) Mouse Untagged Clone

CAT#: MC202104

Guca2b (untagged) - Mouse guanylate cyclase activator 2b (retina) (Guca2b), (10ug)


  "NM_008191" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Guca2b"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Guca2b
Synonyms AV066530; Gcap2; Ugn
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC024373 sequence for NM_008191
CCCACGCGTCCGCCCACGCGTCCGGGAACCCAGAGGTGTGAGCTTGGAAGCGAGGCCATGTCAAGAAGCC AACTGTGGGCTGCCGTCGTCCTGCTGCTGCTCCTGCAGAGTGCACAGGGTGTCTACATCAAGTACCATGG CTTCCAAGTCCAGCTGGAATCAGTGAAGAAGCTGAATGAGTTGGAGGAGAAGGAGATGTCCAATCCCCAG CCGCGGAGAAGTGGCCTCCTCCCTGCTGTGTGCCATAACCCAGCCTTGCCCTTGGACCTCCAGCCTGTTT GTGCCTCCCAGGAAGCTGCCAGCACCTTCAAGGCCTTGAGGACCATCGCCACCGACGAATGTGAACTGTG TATAAATGTTGCCTGTACAGGCTGCTGATGAAATGACTCTGGGTCTTAAGACCACTCCGGACACTTTCCC CACAGCCCAACCTGTCCATACTTAGGCACCATTGAAGTAATCGCCATCCTCCCAGCATAAATGGATCCTT AGCAAGGCAATATGGATGCAGAGTTGCCATATTTGGCCCCCAGGCAGCTGCACCTGAATAAAAAATGCTA CCCCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_008191
ORF Size 321 bp
Insert Size 321
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC024373, AAH24373
RefSeq Size 605
RefSeq ORF 321
Locus ID 14916
Gene Summary This gene encodes a member of the guanylin family and preproprotein that is proteolytically processed to generate a mature protein product. The mature protein product, known as uroguanylin, is an endogenous ligand for the guanylate cyclase-C receptor and may regulate salt and water homeostasis in the intestine and kidneys. Homozygous knockout mice for this gene exhibit impaired sodium chloride excretion and elevated arterial pressure. This gene is present in a gene cluster with a related guanylin family member on chromosome 4. [provided by RefSeq, Sep 2015]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.