Dph3 (NM_172254) Mouse Untagged Clone

CAT#: MC202244

Dph3 (untagged) - Mouse DPH3 homolog (KTI11, S. cerevisiae) (Dph3), transcript variant 1, (10ug)


  "NM_172254" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Dph3"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Dph3
Synonyms DELGIP1; DelgipP1; Desr1; KTI11; Zcsl2
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC029910 sequence for NM_172254
GGAAGACCGGGCCTTACCCTGCCTGGGCGCAGGTAGGCAAGCTGATGCGGTGCCGACCGGGTGACCATGG CGGTGTTTCACGACGAGGTGGAGATCGAGGACTTTCAATATGACGAGGACTCGGAGACATATTTCTACCC TTGCCCCTGTGGGGATAACTTTGCCATCACCAAGGAAGATTTGGAAAATGGAGAAGATGTGGCCACGTGT CCTAGCTGCTCACTCATTATAAAAGTGATTTATGACAAAGATCAGTTCATGTGTGGAGAAACAGTCCCAG CACCTTCAACCAACAAGGAGTTAGTTAAATGCTGAAGAGGCTCTCAGGTACCCACATCCTGAACCGTGGG GGCTGAGCCCAGGTGGATGGATCCAGTGCAGAGTTACCAACCTCCTCGATGGGCAGCCTCAGGGGTGTGA TCTTCATCAGCCACTGAACTCAGCATGAAAAAGGGAGCCTATGACATGCCAGCCCTGGATTCCATACTGG GACTGGAAGGATTCCTAATTGTCCGTCTGAATTTAAGGAAGAGCCTTATTATAAACTGTGGTTTTTCCTT CAGTCGGCTGCATCATTTGAACATCTGGAAATTCATTTTCTGAAAATAACATCATCCGCCTCAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_172254
ORF Size 249 bp
Insert Size 249
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC029910, AAH29910
RefSeq Size 677
RefSeq ORF 249
Locus ID 105638
Gene Summary Essential for the first step in the synthesis of diphthamide, a post-translational modification of histidine which occurs in elongation factor 2. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longer isoform (1). Both variants 1 and 3 encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.