Hbb (NM_016956) Mouse Untagged Clone

CAT#: MC202245

Hbb (untagged) - Mouse hemoglobin, beta adult minor chain (Hbb-b2), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Hbb
• Synonyms: AI036344; beta2; Hbb2; Hbbt2
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC027434 sequence for NM_016956
  GTTGTGTTGACTTGCAACTTCAGAAACAGACATCATGGTGCACCTGACTGATGCTGAGAAGTCTGCTGTC TCTTGCCTGTGGGCAAAGGTGAACCCCGATGAAGTTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTTGTCT ACCCTTGGACCCAGCGGTACTTTGATAGCTTTGGAGACCTATCCTCTGCCTCTGCTATCATGGGTAATCC CAAGGTGAAGGCCCATGGCAAAAAGGTGATAACTGCCTTTAACGAGGGCCTGAAAAACCTGGACAACCTC AAGGGCACCTTTGCCAGCCTCAGTGAGCTCCACTGTGACAAGCTGCATGTGGATCCTGAGAACTTCAGGC TCCTGGGCAATGCGATCGTGATTGTGCTGGGCCACCACCTGGGCAAGGATTTCACCCCTGCTGCACAGGC TGCCTTCCAGAAGGTGGTGGCTGGAGTGGCCACTGCCCTGGCTCACAAGTACCACTAAGCCCCTTTTCTG CTATTGTCTATGCACAAAGGTTATATGTCCCCTAGAGAAAAACTGTCAAGTGTGGGGAAATGATGAAGAC CTTTGGGCATCTAGCTTTTATCTAATAAATGATATTTACTGTCATCTCAAAAAAAAAAAAAAAAAAAAAA AA
• Restriction Sites: RsrII-NotI
• ACCN: NM_016956
• ORF Size: 444 bp
• Insert Size: 444
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: BC027434, AAH27434
• RefSeq Size: 632
• RefSeq ORF: 444
• Locus ID: 15130
• Gene Summary: This gene encodes a beta polypeptide chain found in adult hemoglobin, which consists of a tetramer of two alpha chains and two beta chains, and which functions in the transport of oxygen to various peripheral tissues. This gene is one of a cluster of beta-hemoglobin genes that are distally regulated by a locus control region, and which are organized along the chromosome in the order of their developmental expression. In mouse, two major strain-specific haplotypes of the beta-globin gene cluster are found - a "single" haplotype found in C57BL/-type strains, which includes two highly similar adult beta-globin genes, beta s and beta t, and a "diffuse" haplotype found in strains such as BALB/c and 129Sv, which includes two somewhat diverse adult beta-globin genes, beta-major and beta-minor. This gene represents the beta-minor adult gene found in the "diffuse" haplotype. Primary chromosome 7 of the mouse reference genome assembly, which is derived from C57BL/6 strain mice, represents the "single" haplotype, while the "diffuse" haplotype is represented in the reference genome collection by the BALB/c strain alternate contig, NT_095534.1. [provided by RefSeq, May 2013]