Rpl37 (NM_026069) Mouse Untagged Clone

CAT#: MC202259

Rpl37 (untagged) - Mouse ribosomal protein L37 (Rpl37), (10ug)


  "NM_026069" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Rpl37"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Rpl37
Synonyms 3110005M08Rik
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC054388 sequence for NM_026069
CTTTGGCCTCGCCGGTAGAAGCAAGATGACGAAGGGAACGTCATCCTTTGGTAAGCGTCGCAACAAGACG CACACGCTGTGCCGCCGCTGTGGCTCCAAGGCCTACCACCTTCAGAAGTCGACTTGTGGCAAGTGTGGCT ACCCTGCCAAGCGCAAGAGGAAGTATAACTGGAGTGCCAAGGCTAAGAGACGAAACACTACCGGGACTGG TCGGATGAGGCACCTAAAGATTGTCTACCGCAGATTCAGACATGGATTCCGTGAGGGAACAACGCCGAAA CCCAAGAGGGCAGCTGTCGCAGCATCCAGTTCTTCTTAAGGATTTCAATCAGTCATAAAATAAATGTTCT GCTTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_026069
ORF Size 294 bp
Insert Size 294
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC054388, AAH54388
RefSeq Size 394
RefSeq ORF 294
Locus ID 67281

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.