Pla2g2a (NM_001082531) Mouse Untagged Clone

CAT#: MC202297

Pla2g2a (untagged) - Mouse phospholipase A2, group IIA (platelets, synovial fluid) (Pla2g2a), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Pla2g2a
• Synonyms: EF; Mom1; Pla2; sPLA2; sPla2-IIA
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC045156 sequence for NM_001082531
  CAAGAAACCATACCACCATCCAAGAGAGCTGACAGCATGAAGGTCCTCCTGCTGCTAGCAGCCTCGATCA TGGCCTTTGGCTCAATACAGGTCCAAGGGAACATTGCGCAGTTTGGGGAAATGATTCGGCTTAAGACAGG AAAGAGAGCTGAGCTTAGCTATGCCTTCTATGGATGCCACTGTGGCCTGGGTGGCAAAGGATCCCCCAAG GATGCCACAGACCGGTGCTGTGTTACTCATGACTGTTGCTACAAGAGCCTGGAGAAAAGTGGATGTGGTA CTAAGTTACTGAAATACAAGTACTCCCACCAAGGGGGCCAAATCACCTGTTCTGCAAACCAGAACTCCTG TCAGAAACGGCTGTGTCAGTGCGATAAAGCCGCCGCTGAATGTTTCGCCCGGAACAAGAAAACCTACAGT TTAAAGTACCAGTTCTACCCCAACATGTTTTGCAAAGGGAAGAAGCCCAAATGCTGAAAAGAGCCATCTC CTGAAACACCCGGACATGCGCGTCTCCCATCACACCTCTCCCAGCCCCACCAAGTTTCCCGGTGATAAAG GAAACACCCCTCTCCCACCCTAGAGGCAAGGTGGGGGCCCTTCTGTCTTCACCCAGAATGAGACACAGAA GTCTGCTGAGTCAGGCTGACCTTTCCCCACCACTCCACTGCCTTGAATCTGTCTACTTCCACCTTTCTCT TGGCATCCAACTTCCTGCTTCGTACCTAAGAGAGTCCTGGGAGGCCCTCACAAGTAAAGCAATTCATCAG ACAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: RsrII-NotI
• ACCN: NM_001082531
• ORF Size: 441 bp
• Insert Size: 441
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: BC045156, AAH45156
• RefSeq Size: 793
• RefSeq ORF: 441
• Locus ID: 18780
• Gene Summary: Proteins belonging to the phospholipase A2 (PLA2) family hydrolyze phospholipids into sn2 fatty acids and lysophospholipids. They function in a variety of cellular processes, including the digestion of phospholipids and the production of molecules that induce inflammatory responses. This gene encodes a member of the group II class of secretory PLA2s. The secreted enzyme binds to heparin on the cell surface. Mutations in this gene increase the occurrence of intestinal polyps caused by a dominant mutation in the adenomatosis polyposis coli gene. A frameshift inactivates this gene product in some mouse strains including the strain of the reference genome, C57BL/6J, whereas a functional protein is produced in other strains. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (1, coding) contains a gap in the coding region to represent the functional allele that is not present in the the strain of the reference genome, C57BL/6J. Sequence Note: This RefSeq record was created to represent the transcript and the full-length, functional protein that is expressed in several strains. It does not contain a one nucleotide deletion that causes a frameshift in the CDS of several strains, including the strain of the reference genome, C57BL/6J.