1810009A15Rik (NM_025463) Mouse Untagged Clone

CAT#: MC202324

1810009A15Rik (untagged) - Mouse RIKEN cDNA 1810009A15 gene (1810009A15Rik), (10ug)


  "NM_025463" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "1810009A15Rik"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol 1810009A15Rik
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC047099 sequence for NM_025463
GAATGAGCCGCGGAGTGTAGCCATGGCACCTCCGGGAGGAAAGATCAATCGTCCCCGGACGGAGCTGAAG AAGAAGTTGTTCAAGCGCCGCAGGGTATTAAGCAGGGATCGGCGACGGAAACGCCAGGTGGTCGGGGCTG TGATAGACGAAGGGCTGACTACGAAGCACCACCTCAAGAAGCGGGCGTCCAGTGCTCGTGCCAACATCAC GCTGTCTGGGAAGAAGCGCAGGAAACTCTTGCAGCAGATCCGACTTGCCCAGAAAGAAAAAGCAGCCATG GAAGTGGAAGCCCCCTCCAAGTCAACCAGGACTAGTCAGCCACAGCCCAAGCAACAAAAGAAGATAAAAG CTCCCCAGGACGTAGCTATGGAGGATCTTGAAGATAAGAGCTAAAATCCCTGCCTCTTCTACCAGAAGAT GGTCAACAGCACTGAGAAAGATTTGGAGGAACTTTGGAAAAAATATTAGCATATTTCACTTTCCTAGACA CCTCTTCTACAGCGGACCCTGACCTCCCCTGGAGGTGTATATTGGGACCGAAGAGGACACAGAGAAAGAC TGGAGGGCCACCTCTAGCAGTCAACTCCTTTTGTAATAAAGCTTTAGTGCGTTCAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_025463
ORF Size 372 bp
Insert Size 372
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC047099, AAH47099
RefSeq Size 629
RefSeq ORF 372
Locus ID 66276
Gene Summary This gene shares three exons in common with another gene, LBH domain containing 1 (GeneID:102308570), but the encoded protein uses a reading frame that is different from that of the LBH domain containing 1 gene. [provided by RefSeq, Nov 2017]
Transcript Variant: This variant (1) represents the protein-coding transcript.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.