Arl2 (NM_019722) Mouse Untagged Clone

CAT#: MC202393

Arl2 (untagged) - Mouse ADP-ribosylation factor-like 2 (Arl2), (10ug)


  "NM_019722" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Arl2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Arl2
Synonyms 2610009M23Rik; AI115441; AW553335
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC060259 sequence for NM_019722
AGCGGCCGGGAGGGGGCTACGGGATCATGGGGCTTCTGACCATTCTGAAGAAGATGAAGCAGAAAGAGCG AGAGCTGCGGCTGCTCATGCTTGGCTTGGACAACGCTGGCAAAACAACCATCCTCAAGAAGTTCAATGGA GAAGACGTGGACACCATCTCCCCGACACTGGGCTTCAACATCAAGACCCTGGAGCACCGCGGATTCAAGC TGAACATCTGGGATGTAGGTGGCCAGAAGTCTCTGCGCTCCTACTGGAGGAACTACTTTGAGAGCACGGA TGGCCTCATCTGGGTGGTGGACAGCGCCGACCGCCAGCGCATGCAGGACTGTCAGCGAGAGCTGCAGAGC CTACTGGTGGAGGAGCGCCTGGCTGGAGCAACCCTCCTCATCTTTGCCAATAAGCAGGACCTGCCTGGAG CACTGTCCTGTAATGCTATTCAGGAGGCCCTGGAGCTGGACTCCATCCGCAGCCACCACTGGCGCATCCA GGGCTGCAGTGCTGTCACAGGGGAAGACCTGCTGCCTGGCATCGACTGGCTCCTTGATGACATTTCCAGT CGTGTCTTTACTGCCGACTGAGCTTCTTCAGTGTCCCCAGGTCCCTGTCCTCATCAGACACCAGCCAGAG GGATGAGCACCAGCTGGCCAGACTAACACTCCCAACCCCACCATGACCTGCTGCTGCTATTACTGCCCAT TGCTGCTCCCCCGGGTGAGGGCTGTCACCCTGTCTCCCAAAGTGGCCTGCAGCTGCCATGCCAAAAGGAA AGGCTGGGCTGGGAGGGACTACCTGCTGCTGCCAGGGTCCTAGGTGTCGCCTCGCCTCGGTCCAGCAGTG AGAATAAAGCACTCTTCACCCAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAA
Restriction Sites AscI-NotI     
ACCN NM_019722
ORF Size 555 bp
Insert Size 555
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC060259, AAH60259
RefSeq Size 931
RefSeq ORF 555
Locus ID 56327
Gene Summary Small GTP-binding protein which cycles between an inactive GDP-bound and an active GTP-bound form, and the rate of cycling is regulated by guanine nucleotide exchange factors (GEF) and GTPase-activating proteins (GAP). GTP-binding protein that does not act as an allosteric activator of the cholera toxin catalytic subunit. Regulates formation of new microtubules and centrosome integrity. Prevents the TBCD-induced microtubule destruction. Participates in association with TBCD, in the disassembly of the apical junction complexes. Antagonizes the effect of TBCD on epithelial cell detachment and tight and adherens junctions disassembly. Together with ARL2, plays a role in the nuclear translocation, retention and transcriptional activity of STAT3. Component of a regulated secretory pathway involved in Ca(2+)-dependent release of acetylcholine. Required for normal progress through the cell cycle. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.