Pyurf (NM_025574) Mouse Untagged Clone

CAT#: MC202444

Pyurf (untagged) - Mouse phosphatidylinositol glycan anchor biosynthesis, class Y (Pigy), nuclear gene encoding mitochondrial protein, (10ug)


  "NM_025574" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Pyurf"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Pyurf
Synonyms 2610022G08Rik; AI847956; Prey
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC029232 sequence for NM_025574
CGGACGCGTGGGTCGGACGCGTGGGTTCTGAGCCGCCATGCTGAGCGCCACGTGCCGCAGGCTCGCCCCG GCGCTGCGGAGGCTCCGCGCACTGTCTGCAGTCGCCGGGAGGTTTCTGCAAGTGCCCGGGGCCAGGCTCT GCTCTGACCAGAGCGAGAGGGCTGAGCAGCCCCACACCTTCCACCCGGCGCTGCTGCAGTTCCTGGTGTG TCCGCTCTCCAAGAAGCCGCTTAGATATGAAGCATCGACAAATGAATTGGTTAATGAAGAGTTGGGAATA GCATATCCAATCATTGATGGGATCCCTAATATGATACCACAGGCAGCAAGGACCACACGTCAAAATGAGA AGCAAGAAGAAGCTGAGCAACCCTAGACCCTGATTGTTAAAAGCATAATTACTGAGTTCTCTTAATTCTG TACACCTTTAACACAGGGAGGGAGAGTTGGGGTGGAACAGTAATTCTGCCTCGGCCTGCTTGACTGTTCT TCCCCTGCCCTCTTTAGCAGGACTATTCTGATCTGCTTTTCTGGAGGAGAATGTCCCACAGGGCTGCACC AGCACAGACCACAGACAGGCTTTGACTTTACAGTGTGCTTTTGCCAACCACCATAGCAATGTGTGTGTTC TCCCACCTTTGGAACCAGAAAGGTCTAAAACTCTTTAAGTGTAGTTAGTACAACCATAGCCGGGACAGCA CGTGGATTAATAAGAGATCTGCAGCAACATCTGTGAAAACTACATATAAACCCATTTGATTTATAAAAAA AAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_025574
ORF Size 339 bp
Insert Size 339
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC029232, AAH29232
RefSeq Size 779
RefSeq ORF 339
Locus ID 66459
Gene Summary This gene encodes a small protein with a conserved DUF343 domain. The human ortholog of this gene expresses two distinct proteins from upstream and downstream coding regions. The upstream CDS encoding a DUF343 domain-containing protein has been conserved at this mouse locus, but the downstream CDS encoding a subunit of an enzyme involved in glycosylphosphatidylinositol biosynthesis has not been conserved. Instead, a separate locus on mouse chromosome 9 encodes the mouse homolog of the human phosphatidylinositol glycan anchor biosynthesis, class Y protein. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.