Prdx2 (NM_011563) Mouse Untagged Clone

CAT#: MC202464

Prdx2 (untagged) - Mouse peroxiredoxin 2 (Prdx2), nuclear gene encoding mitochondrial protein, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Prdx2
• Synonyms: AL022839; Band-8; NkefB; PRP; PrxII; Tdpx1; TDX1; Torin; TPx; TPx-B; TR; TSA
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC081454 sequence for NM_011563
  TGGACGTCCGTGTGTCCGGCTCTTGCTCACGCAGTCATGGCCTCCGGCAACGCGCAAATCGGAAAGTCGG CTCCTGACTTCACGGCCACAGCGGTGGTGGATGGTGCCTTCAAGGAAATCAAGCTTTCGGACTACAGAGG GAAGTACGTGGTCCTCTTTTTCTACCCACTGGACTTCACTTTTGTTTGCCCCACGGAGATCATCGCTTTT AGCGACCATGCTGAGGACTTCCGAAAGCTAGGCTGCGAGGTGCTGGGAGTGTCTGTGGACTCTCAGTTCA CCCACCTGGCGTGGATCAATACCCCACGGAAGGAGGGAGGCTTGGGCCCCCTGAATATCCCTCTGCTTGC TGACGTGACTAAAAGCTTGTCCCAGAATTACGGCGTGTTGAAAAATGATGAGGGCATTGCTTACAGGGGT CTCTTTATCATCGATGCCAAGGGTGTCCTTCGCCAGATCACAGTCAATGACCTACCTGTGGGACGCTCTG TAGACGAGGCTCTCCGCCTAGTCCAGGCCTTTCAGTATACAGACGAGCATGGGGAAGTCTGCCCTGCTGG CTGGAAGCCCGGCAGTGACACCATCAAGCCCAATGTGGATGACAGCAAGGAATACTTCTCCAAACACAAC TGAGATGGGTAAACATGGGTGAGCCTGAAGCTTGGATTTCACCTGTGCCCCAACCTGGATGTCCTGTGCT GGCCCAGAAAATGCTAGATTTTCCTCCACTCTCTGAAGGGGCTGGAGTCTAGGCTGAGGTTTTCTCATTA CCCACCTGGAATCTGGTGAATAGTGATCCTGCCCTGAGCACACCTAGCTGGGCCCAGGTCTATAGGAAAC CAATAAAGTATTAGGGACAGTGTAAAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: AscI-NotI
• ACCN: NM_011563
• ORF Size: 597 bp
• Insert Size: 597
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: BC081454, AAH81454
• RefSeq Size: 886
• RefSeq ORF: 597
• Locus ID: 21672
• Gene Summary: Involved in redox regulation of the cell. Reduces peroxides with reducing equivalents provided through the thioredoxin system. It is not able to receive electrons from glutaredoxin. May play an important role in eliminating peroxides generated during metabolism. Might participate in the signaling cascades of growth factors and tumor necrosis factor-alpha by regulating the intracellular concentrations of H(2)O(2). [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein.