Atp5h (NM_027862) Mouse Untagged Clone

CAT#: MC202480

Atp5h (untagged) - Mouse ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d (Atp5h), nuclear gene encoding mitochondrial protein, (10ug)


  "NM_027862" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Atp5h"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Atp5h
Synonyms 0610009D10Rik; Atp5pd
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC081431 sequence for NM_027862
AGAGCACTCCGCCGGGGGTCGGTGAAGTATCCCAAGATGGCTGGGCGTAAACTTGCTCTAAAAACCATTG ATTGGGTATCTTTTGTGGAGGTCATGCCCCAAAACCAGAAGGCAATTGGAAATGCCCTGAAGTCCTGGAA TGAGACCTTCCACGCCAGGTTGGCTAGTCTGTCTGAGAAACCACCTGCGATTGACTGGGCTTACTACAGG GCCAATGTGGCCAAGCCTGGCTTGGTGGATGATTTTGAAAAGAAGTATAATGCCCTGAAGATTCCTGTGC CTGAGGATAAATACACAGCCCTGGTGGACCAGGAGGAGAAGGAGGATGTGAAGAGCTGTGCTGAGTTTGT GTCTGGATCCCAGCTCAGGATCCAGGAGTATGAGAAGCAGCTGGAGAAAATGAGGAACATAATTCCCTTT GACCAGATGACCATTGATGACTTGAATGAGATCTTCCCAGAAACCAAGCTGGACAAAAAGAAGTACCCGT ACTGGCCCCACCAGCCCATCGAGAACCTGTGAAGCAGCCTGGGACGGAGCCCCGGCCGACATGAAATAAA ACATTTAAATAGTAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites AscI-NotI     
ACCN NM_027862
ORF Size 486 bp
Insert Size 486
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC081431, AAH81431
RefSeq Size 596
RefSeq ORF 486
Locus ID 71679
Gene Summary Mitochondrial membrane ATP synthase (F(1)F(0) ATP synthase or Complex V) produces ATP from ADP in the presence of a proton gradient across the membrane which is generated by electron transport complexes of the respiratory chain. F-type ATPases consist of two structural domains, F(1) - containing the extramembraneous catalytic core, and F(0) - containing the membrane proton channel, linked together by a central stalk and a peripheral stalk. During catalysis, ATP synthesis in the catalytic domain of F(1) is coupled via a rotary mechanism of the central stalk subunits to proton translocation. Part of the complex F(0) domain and the peripheric stalk, which acts as a stator to hold the catalytic alpha(3)beta(3) subcomplex and subunit a/ATP6 static relative to the rotary elements. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.