Selenow (NM_009156) Mouse Untagged Clone

CAT#: MC202669

Sepw1 (untagged) - Mouse selenoprotein W, muscle 1 (Sepw1), (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Symbol: Selenow
• Synonyms: selW; Sepw1
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC052719 sequence for NM_009156
  CTTGTTGCTTGTGGGTCGGGTCCTCGTGTTGTGCGGGGATGCGACGTGCAGCTATGGCGCTCGCCGTTCG AGTCGTGTATTGTGGAGCTTGAGGCTATAAGCCCAAGTACCTCCAGCTCAAGGAGAAGCTAGAACATGAG TTCCCCGGATGCCTGGACATTTGTGGCGAGGGGACTCCCCAGGTCACCGGGTTCTTTGAAGTGACAGTAG CCGGGAAGTTGGTCCACTCCAAGAAGAGAGGTGATGGCTATGTGGATACAGAGAGCAAGTTCCGGAAACT GGTGACCGCCATCAAAGCTGCCTTGGCTCAGTGCCAGTGAGCCCTAGAGGCAGGGTCCTGAAAGCTCCTG GCCGGCCTTCCTTGGCAGCCGCTTCATGACAGGAAGGACTGAAATGTCTTAGACCTGTGGTCTTTCCTCG ATGTTCCTGCGGCCACCAAGTCAGGCCAGAGATGGATTCTGGCTGTGGGTGCCTCCCCAGAATCTACCCG TGCACGCAGCCTGCCCTGCCCCCCTGCCCTCTTCCCCACCTCTCTCTCTGAATTCCCCCATTGTTTCCCA CCCACCCTCCTGCTTTGCTTTCCCTTTCCACCTCAAGACTTCAAGAAGACAGGCAGCCATGTTTCCAGGT GTTCCCGGTTGAATAAAGTTTGGATGAGGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: AscI-NotI
• ACCN: NM_009156
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins.
• OTI Annotation: This clone encodes a selenoprotein containing the rare amino acid selenocysteine (Sec). Sec is encoded by UGA codon, which normally signals translational termination. Expression of this clone is not guaranteed due to the nature of selenoproteins.

Reference Data

• RefSeq: BC052719, AAH52719
• RefSeq Size: 690
• Locus ID: 20364
• Gene Summary: This gene encodes a selenoprotein containing a selenocysteine (Sec) residue, which is encoded by the UGA codon that normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, the Sec insertion sequence (SECIS) element that is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. This protein is highly expressed in skeletal muscle and brain. It belongs to the SelWTH family, which possesses a thioredoxin-like fold and a conserved CxxU (C is cysteine, U is Sec) motif, and has been shown to function as a glutathione-dependent antioxidant in vivo. Studies in mouse suggest that this selenoprotein is involved in muscle growth and differentiation, and in the protection of neurons from oxidative stress during neuronal development. [provided by RefSeq, Apr 2017]