Apoc1 (NM_007469) Mouse Untagged Clone

CAT#: MC202950

Apoc1 (untagged) - Mouse apolipoprotein C-I (Apoc1), transcript variant 1, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Apoc1
• Synonyms: apo-CI; Apo-CIB; apoC-I; ApoC-IB
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC019398 sequence for NM_007469
  CCCTCCTGAGAGATCCTTAGATCCAGGGTGCCCCTCCAACCAGGATGAGGCTCTTCATCGCTCTTCCTGT CCTGATTGTGGTCGTAGCCATGACCTTGGAAGGCCCAGCCCCCGCCCAGGCGGCCCCGGATTTGTCCGGA ACATTGGAGAGCATACCGGATAAACTGAAGGAGTTTGGGAACACTTTGGAAGACAAGGCCCGGGCAGCCA TTGAACATATCAAACAGAAGGAAATTTTGACCAAGACCCGGGCCTGGTTCTCAGAGGCATTTGGCAAAGT GAAGGAGAAGTTGAAGACCACGTTCTCCTGAGCACCTGGCGGGCCACCTCGAAGCATCAAGGACATCCAC GTAATGTGCCAGGTCCCTCTTCATCACAGACCAATAAAAAACGTGTAGAAGGCAAAAAAAAAAAAAAAAA
• Restriction Sites: RsrII-NotI
• ACCN: NM_007469
• ORF Size: 267 bp
• Insert Size: 267
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: BC019398, AAH19398
• RefSeq Size: 420
• RefSeq ORF: 267
• Locus ID: 11812
• Gene Summary: This gene encodes a precursor plasma protein that is cleaved to yield a signal peptide and two alternatively processed mature peptides. The encoded protein, which is a component of chylomicrons, very low density lipoproteins and high density lipoproteins, transports lipids from the intestines to other locations in the body. This protein binds to free fatty acids preventing their uptake by cells. This protein is a cofactor for lecithin cholesterol acyltransferase, an enzyme that catalyzes the conversion of free cholesterol to cholesteryl esters. The encoded protein inhibits the activity of the cholesteryl ester transfer protein which promotes the exchange of neutral lipids between lipoproteins. In humans this gene is associated with risk of coronary artery disease and age-associated memory impairment. Mice lacking this gene demonstrate impaired memory. This gene is clustered with three other apolipoprotein genes on chromosome 7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
  Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein.