Hist1h2bc (NM_023422) Mouse Untagged Clone

CAT#: MC202960

Hist1h2bc (untagged) - Mouse histone cluster 1, H2bc (Hist1h2bc), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Hist1h2bc
• Synonyms: 2610022J01Rik; H2bfs; R74621
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC019673 sequence for NM_023422
  GTTTGGAAATCCGAAGATGCCTGAGCCTGCGAAGTCCGCTCCCGCCCCGAAGAAGGGCTCCAAGAAGGCC GTCACCAAGGCCCAGAAGAAGGACGGCAAGAAGCGCAAGCGCAGCCGCAAGGAGAGCTACTCGGTGTACG TGTACAAGGTGCTGAAGCAAGTGCACCCCGACACCGGCATCTCCTCCAAGGCCATGGGCATCATGAACTC GTTCGTGAACGACATCTTCGAGCGCATCGCGGGCGAGGCGTCCCGCCTGGCGCATTACAACAAGCGCTCG ACCATCACGTCCCGGGAGATCCAGACGGCCGTGCGCCTGCTGCTGCCCGGGGAGCTGGCCAAGCACGCGG TGTCGGAGGGCACCAAGGCGGTCACCAAGTACACCAGCTCCAAGTGATCCTGCCAAGAGGAGTAGACCTG ACATCGTTTCTACCACTCATCAGTGCTGGATGCTGTAACCTCAAGACAGTGCAAATGGGTGATACTAGCA GATTAACCACCATAGTTTCAAAACTCAAGGAACAACTGAGAAGCACCATTTTAAATTCTATAAAAATGTT CACTGTAGAAATTTGTGATAAGAAAGACACACAGACGTAGAAAATGAGAATACTTGCTGCAAAATTAAGA TGCTCCTAGCAAAAGAATGCTTTTAAGTGTTTGTCATGTATGGATATATATGATGTATATATAATAAATG TCATGTAAAGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: RsrII-NotI
• ACCN: NM_023422
• ORF Size: 381 bp
• Insert Size: 381
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: BC019673, AAH19673
• RefSeq Size: 740
• RefSeq ORF: 381
• Locus ID: 68024
• Gene Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene encodes a replication-dependent histone that is a member of the histone H2B family and generates two transcripts through the use of the conserved stem-loop termination motif, and the polyA addition motif. [provided by RefSeq, Aug 2015]
  Transcript Variant: This variant (1) represents the longer, two exon transcript and contains a polyA signal and site. Variants 1 and 2 encode the same protein.