Cox6c (NM_053071) Mouse Untagged Clone

CAT#: MC203143

Cox6c (untagged) - Mouse cytochrome c oxidase, subunit VIc (Cox6c), nuclear gene encoding mitochondrial protein, (10ug)


  "NM_053071" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Cox6c"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cox6c
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC024666
CGGACGCGTGGGCGGACGCGTGGGCGAGAACCGGGAAGGACGTTGGTGTAGAGGACATTGGCTACCATGA GTTCCGGTGCGCTGTTGCCCAAACCACAGATGCGTGGTCTTCTGGCCAAGCGTCTGCGGGTTCATATTGC TGGCGCATTCATTGTGGCCCTGGGAGTTGCCGCTGCCTATAAGTTTGGCGTGGCTGAGCCAAGAAAGAAG GCGTATGCAGAATTCTACAGAAATTATGATTCCATGAAAGATTTCGAAGAGATGAGGAAGGCTGGTATCT TTCAGAGTGCCAAGTGATTTCAGAATGCAAAGAATTCTTTGGATTGCGCTCCAAAGAAGTTCATTGCTGA CCTGCGCTCCTGAACTATGAAACATGAATATGTGTGGGCTAAGGAATAGTTTCTTTCAATAAACAGTAAT TATATGGACAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_053071
ORF Size 231 bp
Insert Size 231
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC024666, AAH24666
RefSeq Size 444
RefSeq ORF 231
Locus ID 12864

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.