Dbi (NM_007830) Mouse Untagged Clone

CAT#: MC203145

Dbi (untagged) - Mouse diazepam binding inhibitor (Dbi), transcript variant 2, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Dbi
• Synonyms: ACBD1; Acbp; endozepine; EP
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC028874
  GAGCTTGCTCCCGCGCATTCGGCATCCGTATCACCTCACCAGTATGTCTCAGGCTGAATTTGACAAAGCC GCTGAGGAGGTGAAGCGCCTCAAGACTCAGCCAACTGATGAAGAGATGCTGTTCATCTACAGTCACTTCA AACAAGCTACCGTGGGCGATGTAAATACAGATCGGCCGGGGCTCTTGGACCTCAAGGGCAAAGCCAAGTG GGACTCGTGGAACAAGCTGAAAGGGACTTCCAAGGAAAGTGCCATGAAGACCTATGTGGAAAAGGTAGAC GAGCTAAAGAAGAAATACGGAATATAAATCACCAGATTTGGTGGCCAGCCACACGTGTGACCTGTGAGGA CATAATGCCTTGGTTTTTTCTAATGTAGATGATATGGCTGTGATACATTAGGGCCAGCGTTAACCTCTGC TCCTCCTCCCTCTGTAGTTTTTACCTACAATCAATTAAAAGTACATTTGTTACTCTGAAAAAAAAAAAAA AAAAAAAAAA
• Restriction Sites: RsrII-NotI
• ACCN: NM_007830
• ORF Size: 264 bp
• Insert Size: 264
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: BC028874, AAH28874
• RefSeq Size: 500
• RefSeq ORF: 264
• Locus ID: 13167
• Gene Summary: Binds medium- and long-chain acyl-CoA esters with very high affinity and may function as an intracellular carrier of acyl-CoA esters. It is also able to displace diazepam from the benzodiazepine (BZD) recognition site located on the GABA type A receptor. It is therefore possible that this protein also acts as a neuropeptide to modulate the action of the GABA receptor. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) has an alternate 5' exon, as compared to variant 1. The resulting isoform (2) is shorter and has a different N-terminus, as compared to isoform 1.