Tomm7 (NM_025394) Mouse Untagged Clone

CAT#: MC203313

Tomm7 (untagged) - Mouse translocase of outer mitochondrial membrane 7 homolog (yeast) (Tomm7), nuclear gene encoding mitochondrial protein, (10ug)


  "NM_025394" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Tomm7"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Tomm7
Synonyms 1110020J08Rik; AW047273; Tom7
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC055352
GGACACGGTGGTGGTTGTTGGGCTCCTCGTTCCGCTGGTCCGTCGTCGCCATGGTGAAGCTGAGCAAAGA AGCCAAACAGAGGCTGCAGCAGCTCTTCAAGGGCGGCCAGTTTGCCATCCGCTGGGGCTTTATTCCTCTC GTGATTTACCTGGGATTTACAAGGGGTGCAGATCCTGGAATGCCTGAACCGTCGGTTTTAAGCCTACTTT GGGGATAAAGGACTGTTTGAACATCTGGATTTGGACGCGATCCAACATGGAAGGTGTATACTCCAGCTGG ACAAGAAAGGAGACGTCATTTCAACGATTCTGTGGCAGAGTGGAGGAGCCTATACTGATTTATGATAGAC TATCAAAATAAATATTTTTAACAATGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_025394
ORF Size 168 bp
Insert Size 168
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC055352, AAH55352
RefSeq Size 447
RefSeq ORF 168
Locus ID 66169

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.