Tomm7 (NM_025394) Mouse Untagged Clone
CAT#: MC203313
Tomm7 (untagged) - Mouse translocase of outer mitochondrial membrane 7 homolog (yeast) (Tomm7), nuclear gene encoding mitochondrial protein, (10ug)
"NM_025394" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Tomm7 |
Synonyms | 1110020J08Rik; AW047273; Tom7 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC055352
GGACACGGTGGTGGTTGTTGGGCTCCTCGTTCCGCTGGTCCGTCGTCGCCATGGTGAAGCTGAGCAAAGA AGCCAAACAGAGGCTGCAGCAGCTCTTCAAGGGCGGCCAGTTTGCCATCCGCTGGGGCTTTATTCCTCTC GTGATTTACCTGGGATTTACAAGGGGTGCAGATCCTGGAATGCCTGAACCGTCGGTTTTAAGCCTACTTT GGGGATAAAGGACTGTTTGAACATCTGGATTTGGACGCGATCCAACATGGAAGGTGTATACTCCAGCTGG ACAAGAAAGGAGACGTCATTTCAACGATTCTGTGGCAGAGTGGAGGAGCCTATACTGATTTATGATAGAC TATCAAAATAAATATTTTTAACAATGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_025394 |
ORF Size | 168 bp |
Insert Size | 168 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | BC055352, AAH55352 |
RefSeq Size | 447 |
RefSeq ORF | 168 |
Locus ID | 66169 |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR200023 | Tomm7 (Myc-DDK-tagged) - Mouse translocase of outer mitochondrial membrane 7 homolog (yeast) (Tomm7), nuclear gene encoding mitochondrial protein |
USD 68.00 |
|
MG200023 | Tomm7 (GFP-tagged) - Mouse translocase of outer mitochondrial membrane 7 homolog (yeast) (Tomm7) |
USD 300.00 |
|
MR200023L3 | Lenti ORF clone of Tomm7 (Myc-DDK-tagged) - Mouse translocase of outer mitochondrial membrane 7 homolog (yeast) (Tomm7), nuclear gene encoding mitochondrial protein |
USD 500.00 |
|
MR200023L4 | Lenti ORF clone of Tomm7 (mGFP-tagged) - Mouse translocase of outer mitochondrial membrane 7 homolog (yeast) (Tomm7), nuclear gene encoding mitochondrial protein |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review