Arfrp1 (NM_029702) Mouse Untagged Clone

CAT#: MC203697

Arfrp1 (untagged) - Mouse ADP-ribosylation factor related protein 1 (Arfrp1), transcript variant 2, (10ug)


  "NM_029702" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Arfrp1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Arfrp1
Synonyms 1500006I01Rik; AI480700
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC010713
CCCATGCGTCCGGCTCCGTCCTTCGCTCCTTGTTCCGTCAGGCACTGTGAGGGGTCAGCGTGAGGTCGGT GGGGTTAGGAACGCGGCGGCGGCGGCGGCGGCGGCGGCGGCTCCTCCTCCAAGATCTGAGCAGGGTGCCA GAACAGGATGTACACGCTGCTTTCGGGATTGTACAAGTACATGTTCCAGAAGGATGAATACTGCATCCTG ATCCTGGGCCTGGACAATGCTGGGAAGACGACTTTCCTGGAACAGTCAAAAACACGCTTTAACAAGAACT ACAAGGGGATGAGTCTATCCAAAATCACCACTACCGTGGGTCTAAACATTGGCACTGTGGACGTGGGAAA GGCTCGTCTCATGTTTTGGGACTTAGGTGGGCAGGAAGAGCTGCAGTCTTTGTGGGACAAGTACTATGCA GAGTGCCATGGTGTCATCTATGTAATTGATTCCACTGATGAAGAAAGGCTGTCAGAATCAAAAGAGGCAT TTGAGAAGGTGGTTTCGAGTGAAGCACTGGACGGTGTTCCCATCCTGGTGTTGGCCAACAAGCAGGATGT GGAGACTTGCCTCTCCATTCCTGACATCAAGACTGCATTCAGTGACTGTACCTGTAAGATTGGCCGGCGA GATTGTCTGACCCAGGCCTGCTCTGCCCTCACAGGCAAAGGAGTTCGAGAGGGCATCGAATGGATGGTGA AGTGTGTCGTGCGGAATGTTCACCGGCCACCACGGCAGAGGGACATCACATAAGGACCTCCAACCTCAGT CTTGGACTGTTCGTCTCCTAGTGTTGGAAGAGTATTCTCTGCTGGCTTCTATCCTACTGACACTGGGGGT TGAGCTGCCTTTGTCTGTTCATTCTTTTATTTGCTTTATGTTTTCTCTAAGACAAACTTTTCTCTGTGTC TGGAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_029702
ORF Size 606 bp
Insert Size 606
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC010713, AAH10713
RefSeq Size 934
RefSeq ORF 606
Locus ID 76688
Gene Summary The gene encodes a membrane-associated GTPase that is related to the ADP-ribosylation factor (ARF) and ARF-like (ARL) genes. It plays an essential role in Golgi function controlling recruitment of GRIP domain proteins and ARL1 to the trans-Golgi and trans-Golgi to plasma membrane trafficking of cell surface proteins such as E-cadherin. Deletion of this gene in mice leads to embryonic lethality during early gastrulation, which is at least partly caused by the disruption of E-cadherin trafficking to the cell surface and therefore lack of sufficient cell-cell adhesion in the embryo. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Transcript Variant: This variant (2) uses an alternate splice site in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.