Fhit (NM_010210) Mouse Untagged Clone
CAT#: MC203768
Fhit (untagged) - Mouse fragile histidine triad gene (Fhit), (10ug)
"NM_010210" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Fhit |
Synonyms | AW045638; Fra14A2 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC012662
CCACGCGTCCGGCTTCCTCCTCTTCCTGTGGATCAGTCCTCTGCTTGGAAAACACAGCTTTTACTGTGAG ACCATGTCATTTAGATTTGGCCAACATCTCATCAAGCCCTCTGTGGTTTTTCTCAAAACTGAACTGTCCT TCGCCCTGGTGAATAGGAAACCCGTTGTACCTGGCCATGTCCTCGTGTGCCCGCTGAGGCCAGTAGAGCG CTTCCGTGACCTACATCCTGATGAAGTGGCCGATTTGTTTCAAGTGACCCAGAGAGTTGGGACAGTGGTG GAGAAGCATTTCCAGGGGACCTCCATCACCTTCTCCATGCAAGATGGTCCTGAAGCTGGGCAGACTGTGA AGCATGTACATGTCCACGTTCTTCCCAGGAAGGCAGGGGACTTCCCCCGGAATGACAACATCTATGATGA GCTCCAGAAACATGACAGAGAAGAAGAGGACTCGCCAGCCTTTTGGAGATCTGAGGAGGAGATGGCTGCA GAGGCGGAGGCTCTGCGGGTCTACTTTCAGGCCTGAGAGTAACTCAAACGATTCCCAAGGCATAAGAAAA TGGACCCCATTCTTCTGGAGTCTTCGACATTGGAAATGAAGCTAACCACTCTTTATTGTACCCCACGACC CCACAGCCTTGTACAAAGAACTTTATTGCATGTGTGGAAGCCACTAGTATTATGCTTCCATCACGATGAC AAATAGGCTAGCTTCCCAAACAGTGGCATTGACAGCCTGCCACCGTTCCTCAGTTCTGTACTTAGAATAG TAACATTTCCAAACTGTCCCTGAGCCTAGATGAAAATAAAGTGGTTGCTAAAATATTAAAAAAAAAAAAA AA |
Restriction Sites | RsrII-NotI |
ACCN | NM_010210 |
ORF Size | 453 bp |
Insert Size | 453 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | BC012662, AAH12662 |
RefSeq Size | 842 |
RefSeq ORF | 453 |
Locus ID | 14198 |
Gene Summary | This gene encodes a member of the HIT family of proteins that are characterized by the presence of a histidine triad sequence. The encoded protein is a diadenosine triphosphate hydrolase enzyme that cleaves the P(1)-P(3)-bis(5'-adenosyl) triphosphate (Ap3A) to yield AMP and ADP. This locus is very fragile and has been found to be altered in different types of cancers. Mice lacking the encoded protein display increased susceptibility to spontaneous and induced tumors. Ectopic expression of the encoded protein in such knockout mice inhibits tumor development. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015] Transcript Variant: This variant (2) lacks an alternate exon in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream start codon compared to variant 1. It encodes isoform 2 which has a shorter N-terminus compared to isoform 1. Variants 2, 3 and 4 encode the same protein (isoform 2). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR201063 | Fhit (Myc-DDK-tagged) - Mouse fragile histidine triad gene (Fhit) |
USD 68.00 |
|
MG201063 | Fhit (GFP-tagged) - Mouse fragile histidine triad gene (Fhit) |
USD 300.00 |
|
MR201063L3 | Lenti ORF clone of Fhit (Myc-DDK-tagged) - Mouse fragile histidine triad gene (Fhit) |
USD 500.00 |
|
MR201063L4 | Lenti ORF clone of Fhit (mGFP-tagged) - Mouse fragile histidine triad gene (Fhit) |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review