Fhit (NM_010210) Mouse Untagged Clone

CAT#: MC203768

Fhit (untagged) - Mouse fragile histidine triad gene (Fhit), (10ug)


  "NM_010210" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Fhit"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Fhit
Synonyms AW045638; Fra14A2
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC012662
CCACGCGTCCGGCTTCCTCCTCTTCCTGTGGATCAGTCCTCTGCTTGGAAAACACAGCTTTTACTGTGAG ACCATGTCATTTAGATTTGGCCAACATCTCATCAAGCCCTCTGTGGTTTTTCTCAAAACTGAACTGTCCT TCGCCCTGGTGAATAGGAAACCCGTTGTACCTGGCCATGTCCTCGTGTGCCCGCTGAGGCCAGTAGAGCG CTTCCGTGACCTACATCCTGATGAAGTGGCCGATTTGTTTCAAGTGACCCAGAGAGTTGGGACAGTGGTG GAGAAGCATTTCCAGGGGACCTCCATCACCTTCTCCATGCAAGATGGTCCTGAAGCTGGGCAGACTGTGA AGCATGTACATGTCCACGTTCTTCCCAGGAAGGCAGGGGACTTCCCCCGGAATGACAACATCTATGATGA GCTCCAGAAACATGACAGAGAAGAAGAGGACTCGCCAGCCTTTTGGAGATCTGAGGAGGAGATGGCTGCA GAGGCGGAGGCTCTGCGGGTCTACTTTCAGGCCTGAGAGTAACTCAAACGATTCCCAAGGCATAAGAAAA TGGACCCCATTCTTCTGGAGTCTTCGACATTGGAAATGAAGCTAACCACTCTTTATTGTACCCCACGACC CCACAGCCTTGTACAAAGAACTTTATTGCATGTGTGGAAGCCACTAGTATTATGCTTCCATCACGATGAC AAATAGGCTAGCTTCCCAAACAGTGGCATTGACAGCCTGCCACCGTTCCTCAGTTCTGTACTTAGAATAG TAACATTTCCAAACTGTCCCTGAGCCTAGATGAAAATAAAGTGGTTGCTAAAATATTAAAAAAAAAAAAA AA
Restriction Sites RsrII-NotI     
ACCN NM_010210
ORF Size 453 bp
Insert Size 453
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC012662, AAH12662
RefSeq Size 842
RefSeq ORF 453
Locus ID 14198
Gene Summary This gene encodes a member of the HIT family of proteins that are characterized by the presence of a histidine triad sequence. The encoded protein is a diadenosine triphosphate hydrolase enzyme that cleaves the P(1)-P(3)-bis(5'-adenosyl) triphosphate (Ap3A) to yield AMP and ADP. This locus is very fragile and has been found to be altered in different types of cancers. Mice lacking the encoded protein display increased susceptibility to spontaneous and induced tumors. Ectopic expression of the encoded protein in such knockout mice inhibits tumor development. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
Transcript Variant: This variant (2) lacks an alternate exon in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream start codon compared to variant 1. It encodes isoform 2 which has a shorter N-terminus compared to isoform 1. Variants 2, 3 and 4 encode the same protein (isoform 2).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.