Cryab (NM_009964) Mouse Untagged Clone
CAT#: MC203828
Cryab (untagged) - Mouse crystallin, alpha B (Cryab), (10ug)
"NM_009964" in other vectors (6)
Product Images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Symbol | Cryab |
| Synonyms | Crya-2; Crya2; HspB5; P23 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC010768
GAAACAAGACCATGACAAGTCACCGGTCAGCTCAGCCCTGCCTGTGTTTCTCTTTTCTTAGCTCAGTGAG TACCGGAAGCTTCAGAAGACTGCATATATAAGGGGCCGGCTGGAGCTGCTGCTGAAGGAGTTGACCAGCC AACCGACTCTGCATTCATCTAGCCACAATGGACATCGCCATCCACCACCCCTGGATCCGGCGCCCCTTCT TCCCCTTCCACTCCCCAAGCCGCCTCTTCGACCAGTTCTTCGGAGAGCACCTGTTGGAGTCTGACCTCTT CTCAACAGCCACTTCCCTGAGCCCCTTCTACCTTCGGCCACCCTCCTTCCTGCGGGCACCCAGCTGGATT GACACCGGACTCTCAGAGATGCGTTTGGAGAAGGACAGATTCTCTGTGAATCTGGACGTGAAGCACTTCT CTCCGGAGGAACTCAAAGTCAAGGTTCTGGGGGACGTGATTGAGGTCCACGGCAAGCACGAAGAACGCCA GGACGAACATGGCTTCATCTCCAGGGAGTTCCACAGGAAGTACCGGATCCCAGCCGATGTGGATCCTCTC ACCATCACTTCATCCCTGTCATCTGATGGAGTCCTCACTGTGAATGGACCAAGGAAACAGGTGTCTGGCC CTGAGCGCACCATTCCCATCACCCGTGAAGAGAAGCCTGCTGTCGCCGCAGCCCCTAAGAAGTAGATCCC CTTTCCTCATTGAGTTTTTTTTAAAACAAGGAAGTTTCCCATCAGTGATTGAAAATCTGTGACTAGTGCT GAAGCTTATTAATGCTAAGGGCTGGCCCAGATTATTAAGCTAATAAAAATATCATTCAGCAACAAAAAAA AAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_009964 |
| ORF Size | 528 bp |
| Insert Size | 528 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Reference Data | |
| RefSeq | BC010768, AAH10768 |
| RefSeq Size | 848 |
| RefSeq ORF | 528 |
| Locus ID | 12955 |
| Gene Summary | This gene encodes a member of the small heat-shock protein (HSP20) family. The encoded protein is a molecular chaperone that protects proteins against thermal denaturation and other stresses. This protein is a component of the eye lens, regulates lens differentiation and functions as a refractive element in the lens. This protein is a negative regulator of inflammation, has anti-apoptotic properties and also plays a role in the formation of muscular tissue. Mice lacking this gene exhibit worse experimental autoimmune encephalomyelitis and inflammation of the central nervous system compared to the wild type. In mouse models, this gene has a critical role in alleviating the pathology of the neurodegenerative Alexander disease. Mutations in the human gene are associated with myofibrillar myopathy 2, fatal infantile hypertonic myofibrillar myopathy, multiple types of cataract and dilated cardiomyopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 through 4 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MR201515 | Cryab (Myc-DDK-tagged) - Mouse crystallin, alpha B (Cryab) |
USD 68.00 |
|
| MG201515 | Cryab (GFP-tagged) - Mouse crystallin, alpha B (Cryab) |
USD 300.00 |
|
| MR201515L1 | Lenti ORF clone of Cryab (Myc-DDK-tagged) - Mouse crystallin, alpha B (Cryab) |
USD 500.00 |
|
| MR201515L2 | Lenti ORF clone of Cryab (mGFP-tagged) - Mouse crystallin, alpha B (Cryab) |
USD 500.00 |
|
| MR201515L3 | Lenti ORF clone of Cryab (Myc-DDK-tagged) - Mouse crystallin, alpha B (Cryab) |
USD 500.00 |
|
| MR201515L4 | Lenti ORF clone of Cryab (mGFP-tagged) - Mouse crystallin, alpha B (Cryab) |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China