Vkorc1 (NM_178600) Mouse Untagged Clone

CAT#: MC204511

Vkorc1 (untagged) - Mouse vitamin K epoxide reductase complex, subunit 1 (Vkorc1), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Vkorc1
• Synonyms: D7Wsu86e
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC031732
  CTGGGCTGTACTGTCGACATGGGCACCACCTGGAGGAGCCCTGGACTGGTGCGGCTTGCACTGTGCCTCG CTGGCTTAGCCCTCTCACTGTACGCACTGCACGTGAAGGCGGCGCGCGCCCGCGATGAGAATTACCGCGC GCTCTGCGATGTGGGCACGGCCATCAGCTGTTCCCGCGTCTTCTCCTCTCGGTGGGGCCGGGGCTTTGGG CTGGTGGAGCACATGCTAGGAGCGGACAGCGTCCTCAACCAATCCAACAGCATATTTGGTTGCCTGTTCT ACACCTTACAGCTGTTGTTAGGTTGCTTGAGGGGACGTTGGGCCTCTATCCTACTGGTGCTGAGTTCCCT GGTGTCCGTCGCTGGTTCCGTGTACCTGGCCTGGATCCTGTTCTTTGTGTTATATGATTTCTGTATTGTG TGCATTACCACCTATGCCATCAATGTGGGTCTGATGTTGCTTAGCTTCCAGAAGGTACCAGAACACAAGA CCAAAAAGCACTGAGTTCCCACCTCATGCCAGACTAACCTAACTTGCTTTGCCTTGGCACATGACCCTTG CCCAAGTGTGTGGGTTCCTAGAAGGCCCTACCCACCTCATTCAAACCCCCTCCATAACCACACACAGAGA AATGACCAAACGTGCCTCTAAGTTCTGTTCCCATGGGCTGCATTCTGCTGTTGGTTAAAGAGAAGGATTT TGAACAATAAATTTTTCTATGTTGGTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: RsrII-NotI
• ACCN: NM_178600
• ORF Size: 486 bp
• Insert Size: 486
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: BC031732, AAH31732
• RefSeq Size: 769
• RefSeq ORF: 486
• Locus ID: 27973
• Gene Summary: Vitamin K is essential for blood clotting but must be enzymatically activated. This enzymatically activated form of vitamin K is a reduced form required for the carboxylation of glutamic acid residues in some blood-clotting proteins. The product of this gene encodes the enzyme that is responsible for reducing vitamin K 2,3-epoxide to the enzymatically activated form. Fatal bleeding can be caused by vitamin K deficiency and by the vitamin K antagonist warfarin, and it is the product of this gene that is sensitive to warfarin. In humans, mutations in this gene can be associated with deficiencies in vitamin-K-dependent clotting factors and, in humans and rats, with warfarin resistance. [provided by RefSeq, Jul 2008]