Cdkn2a (NM_009877) Mouse Untagged Clone

CAT#: MC204612

Cdkn2a (untagged) - Mouse cyclin-dependent kinase inhibitor 2A (Cdkn2a), transcript variant 1, (10ug)


  "NM_009877" in other vectors (5)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Cdkn2a"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cdkn2a
Synonyms Arf; ARF-INK4a; INK4a-ARF; Ink4a/Arf; MTS1; p16; p16(INK4a); p16INK4a; p19; p19ARF; Pctr1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC058190
GTACAGCAGCGGGAGCATGGGTCGCAGGTTCTTGGTCACTGTGAGGATTCAGCGCGCGGGCCGCCCACTC CAAGAGAGGGTTTTCTTGGTGAAGTTCGTGCGATCCCGGAGACCCAGGACAGCGAGCTGCGCTCTGGCTT TCGTGAACATGTTGTTGAGGCTAGAGAGGATCTTGAGAAGAGGGCCGCACCGGAATCCTGGACCAGGTGA TGATGATGGGCAACGTTCACGTAGCAGCTCTTCTGCTCAACTACGGTGCAGATTCGAACTGCGAGGACCC CACTACCTTCTCCCGCCCGGTGCACGACGCAGCGCGGGAAGGCTTCCTGGACACGCTGGTGGTGCTGCAC GGGTCAGGGGCTCGGCTGGATGTGCGCGATGCCTGGGGTCGCCTGCCGCTCGACTTGGCCCAAGAGCGGG GACATCAAGACATCGTGCGATATTTGCGTTCCGCTGGGTGCTCTTTGTGTTCCGCTGGGTGGTCTTTGTG TACCGCTGGGAACGTCGCCCAGACCGACGGGCATAGCTTCAGCTCAAGCACGCCCAGGGCCCTGGAACTT CGCGGCCAATCCCAAGAGCAGAGCTAAATCCGGCCTCAGCCCGCCTTTTTCTTCTTAGCTTCACTTCTAG CGATGCTAGCGTGTCTAGCATGTGGCTTTAAAAAATACATAATAATGCTTTTTTTTTGCAATCACGGGAG GGAGCAGAGGGAGGGAGCAGAAGGAGGGAGGGAGGGAGGGAGGGACCTGGACAGGAAAGGAATGGCATGA GAAACTGAGCGAA
Restriction Sites RsrII-NotI     
ACCN NM_009877
ORF Size 510 bp
Insert Size 510
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC058190, AAH58190
RefSeq Size 783
RefSeq ORF 510
Locus ID 12578
Gene Summary Acts as a negative regulator of the proliferation of normal cells by interacting strongly with CDK4 and CDK6. This inhibits their ability to interact with cyclins D and to phosphorylate the retinoblastoma protein. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longer isoform (1, also known as p19ARF) and contains an alternate open reading frame (ARF), when compared to variant 2. Transcripts 1 and 2, encoding p19ARF and p16INK4a, have distinct first exons which contain the translation start codon, and share a common second exon, which is translated in different reading frames. Thus, the p19ARF protein encoded by this variant (1) lacks sequence similarity to the protein product of variant 2 (p16INK4a).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.