Cox8b (NM_007751) Mouse Untagged Clone

CAT#: MC204666

Cox8b (untagged) - Mouse cytochrome c oxidase, subunit VIIIb (Cox8b), nuclear gene encoding mitochondrial protein, (10ug)


  "NM_007751" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Cox8b"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cox8b
Synonyms Cox8h; CoxVIII-H
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC027531
TTCAGGGTGCCTCTTTGGGGCCAAGGAAGGAGTGCGACCCCGAGAATCATGCCAAGGCTCCCCCCTATCC TGCGGCTGCTCCAAGCGCCTGCGAAGTTCACAGTGGTTCCCAAAGCCCATGTCTCTGCCAAGCCAGCCAA AACTCCCACTTCCGCCGTGGAGCAGGCTGTGGGGATCTCAGCCATAGTCGTTGGCTTCATGGTTCCAGCA GGATGGGTCTTAGCCCACTTGGAGAGCTATAAAAAGAGCTCCGCAGCATGAAGTTGCACATCCCTGAGAG ATTTCATTAAACATGTCCATCTGCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAA
Restriction Sites EcoRI-NotI     
ACCN NM_007751
ORF Size 213 bp
Insert Size 213
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC027531, AAH27531
RefSeq Size 372
RefSeq ORF 213
Locus ID 12869
Gene Summary This protein is one of the nuclear-coded polypeptide chains of cytochrome c oxidase, the terminal oxidase in mitochondrial electron transport. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.