Rpl36a (NM_019865) Mouse Untagged Clone

CAT#: MC204668

Rpl36a (untagged) - Mouse ribosomal protein L36A (Rpl36a), (10ug)


  "NM_019865" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Rpl36a"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Rpl36a
Synonyms L44L; Rpl44
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC027515
GCTAGCGCTCCTGCGAACATGGTGAACGTGCCTAAAACCCGCCGGACATTCTGCAAGAAATGTGGGAAGC ACCAACCCCACAAGGTGACACAGTACAAGAAGGGCAAGGATTCTTTGTATGCCCAGGGAAAGCGGCGTTA CGACAGGAAACAGAGTGGCTATGGTGGGCAGACTAAGCCTATTTTCCGCAAAAAGGCTAAAACTACAAAG AAGATTGTGCTGAGACTGGAGTGCGTTGAGCCCAACTGCAGATCTAAGAGGATGCTGGCTATTAAGAGAT GCAAGCATTTTGAATTGGGAGGCGACAAGAAGAGAAAGGGCCAAGTGATCCAGTTCTAAGCAGATTTTGT TATGAAGACAATAAAATCTTGACCTTTCAACCCCTTTGATTGCAGTTGTTCGTTTGGGAGGGAATACATT AAAAGCTTTCAGAAATTAAAAAAAAAAAAAAAAAAA
Restriction Sites EcoRI-NotI     
ACCN NM_019865
ORF Size 321 bp
Insert Size 321
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC027515, AAH27515
RefSeq Size 456
RefSeq ORF 321
Locus ID 19982

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.