Sln (NM_025540) Mouse Untagged Clone

CAT#: MC204674

Sln (untagged) - Mouse sarcolipin (Sln), (10ug)


  "NM_025540" in other vectors (4)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Sln
Synonyms 2310045A07Rik
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC028496
TGGAGGTGGAGAGACTGAGGTCCTTGGTAGCCTGAGTGTGCCCCTGCTCCTCTTCAGGAAGTGAAGACAA GCCTTGGTGTGCAATCACAAGTCCTTCTGGAGTTCTCATCCAGACATTCTGAAGATGGAGAGGTCTACTC AGGAGCTGTTTATCAACTTCACAGTTGTCCTCATCACCGTTCTCCTTATGTGGCTCCTCGTGAGGTCCTA CCAATACTGAGGGGCCATGCTATACTCCAGGGAGTGACTGCTGTGTGCCCCGAGCTTCCAATGCTCTATT GTCATGAGATGCTGCTTCTGGCTCCTCCAGCATCTCTGACCCACACTCACAATGCCTGACACACCGCTGC ACTAGGTCCTTGGCATGTTTTCTAAAGATGCTGTTCTTGTAGGCTGCCCAAAGCTTGCCAGCCAGTGAGC CTTAGCTTTGTTCCCTAGCAAATGTACTATTCAAGTCACCAGGTTAAAATTAAACTGGATTCTTATGATG CAGAGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites EcoRI-NotI     
ACCN NM_025540
ORF Size 96 bp
Insert Size 96
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC028496, AAH28496
RefSeq Size 530
RefSeq ORF 96
Locus ID 66402
Gene Summary Sarcoplasmic reticulum Ca(2+)-ATPases are transmembrane proteins that catalyze the ATP-dependent transport of Ca(2+) from the cytosol into the lumen of the sarcoplasmic reticulum in muscle cells. This gene encodes a small proteolipid that regulates several sarcoplasmic reticulum Ca(2+)-ATPases. The transmembrane protein interacts with Ca(2+)-ATPases and reduces the accumulation of Ca(2+) in the sarcoplasmic reticulum without affecting the rate of ATP hydrolysis. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.