Uqcrq (NM_025352) Mouse Untagged Clone

CAT#: MC204677

Uqcrq (untagged) - Mouse ubiquinol-cytochrome c reductase, complex III subunit VII (Uqcrq), nuclear gene encoding mitochondrial protein, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Uqcrq
• Synonyms: 9.5kDa; 1100001F06Rik; 1500040F11Rik; 5830407L17Rik; AA959903; c1502; QP-C; Qpc; Uqcrb
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC028519
  GGGCGGAAGCCGGCTCAGCGCTCTGGAGGTAGAGGTGACCGATCCTGGGGGTCGGTGTTAAGCCGTGGGA GGTTTTTCGCGAGACTGAGCCACGCGTCTATCTTCTGTCCCAGGGCCGCCGTCATCATGGGCCGCGAGTT TGGGAACCTGGCGCGGATACGGCACGTGATCTCCTACAGCTTGTCGCCCTTTGAGCAGCGCGCCTTCCCA AGCTATTTCAGCAAAGGCATTCCCAACGTGCTGCGCCGCACTCGCGAGCGCATCCTGCGCGTGGCGCCGC CATTTGTAGTGGTCTACCTGATCTACACATGGGGCAACCAGGAGTTTGAGCAGTCGAAAAGGAAGAATCC AGCCATGTATGAAAATGACAAGTAGACGGCCTGCACCTGGGTGACAGTCCCCTGCCTCTGAAAGACCCTT CTCTGGGAGAGGAATCCACACTGTAGTCTTGAAGACAATAAACTACTTATGGACTTCCAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: EcoRI-NotI
• ACCN: NM_025352
• ORF Size: 249 bp
• Insert Size: 249
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: BC028519, AAH28519
• RefSeq Size: 533
• RefSeq ORF: 249
• Locus ID: 22272
• Gene Summary: This is a component of the ubiquinol-cytochrome c reductase complex (complex III or cytochrome b-c1 complex), which is part of the mitochondrial respiratory chain. This subunit, together with cytochrome b, binds to ubiquinone. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein.